ID: 1133808691

View in Genome Browser
Species Human (GRCh38)
Location 16:9144820-9144842
Sequence CTGGGTGTTAGGGACAGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133808681_1133808691 24 Left 1133808681 16:9144773-9144795 CCATCCACTCATGTTTGTTGGGT No data
Right 1133808691 16:9144820-9144842 CTGGGTGTTAGGGACAGTTCAGG No data
1133808687_1133808691 -10 Left 1133808687 16:9144807-9144829 CCCAGGCACTGTGCTGGGTGTTA No data
Right 1133808691 16:9144820-9144842 CTGGGTGTTAGGGACAGTTCAGG No data
1133808684_1133808691 0 Left 1133808684 16:9144797-9144819 CCAGTTTTGTCCCAGGCACTGTG No data
Right 1133808691 16:9144820-9144842 CTGGGTGTTAGGGACAGTTCAGG No data
1133808682_1133808691 20 Left 1133808682 16:9144777-9144799 CCACTCATGTTTGTTGGGTGCCA No data
Right 1133808691 16:9144820-9144842 CTGGGTGTTAGGGACAGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133808691 Original CRISPR CTGGGTGTTAGGGACAGTTC AGG Intergenic
No off target data available for this crispr