ID: 1133810083

View in Genome Browser
Species Human (GRCh38)
Location 16:9154927-9154949
Sequence TGCCTGTCCTGCGGGGAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133810083_1133810095 7 Left 1133810083 16:9154927-9154949 CCCGCTTCCCCGCAGGACAGGCA No data
Right 1133810095 16:9154957-9154979 CTGGAGAGGGTGACCAGGGTAGG No data
1133810083_1133810092 3 Left 1133810083 16:9154927-9154949 CCCGCTTCCCCGCAGGACAGGCA No data
Right 1133810092 16:9154953-9154975 TTCCCTGGAGAGGGTGACCAGGG No data
1133810083_1133810090 -6 Left 1133810083 16:9154927-9154949 CCCGCTTCCCCGCAGGACAGGCA No data
Right 1133810090 16:9154944-9154966 CAGGCACGTTTCCCTGGAGAGGG No data
1133810083_1133810091 2 Left 1133810083 16:9154927-9154949 CCCGCTTCCCCGCAGGACAGGCA No data
Right 1133810091 16:9154952-9154974 TTTCCCTGGAGAGGGTGACCAGG No data
1133810083_1133810089 -7 Left 1133810083 16:9154927-9154949 CCCGCTTCCCCGCAGGACAGGCA No data
Right 1133810089 16:9154943-9154965 ACAGGCACGTTTCCCTGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133810083 Original CRISPR TGCCTGTCCTGCGGGGAAGC GGG (reversed) Intergenic
No off target data available for this crispr