ID: 1133810090

View in Genome Browser
Species Human (GRCh38)
Location 16:9154944-9154966
Sequence CAGGCACGTTTCCCTGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133810083_1133810090 -6 Left 1133810083 16:9154927-9154949 CCCGCTTCCCCGCAGGACAGGCA No data
Right 1133810090 16:9154944-9154966 CAGGCACGTTTCCCTGGAGAGGG No data
1133810084_1133810090 -7 Left 1133810084 16:9154928-9154950 CCGCTTCCCCGCAGGACAGGCAC No data
Right 1133810090 16:9154944-9154966 CAGGCACGTTTCCCTGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133810090 Original CRISPR CAGGCACGTTTCCCTGGAGA GGG Intergenic
No off target data available for this crispr