ID: 1133814431

View in Genome Browser
Species Human (GRCh38)
Location 16:9185635-9185657
Sequence CAGGTTCAGAAACATGTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133814431_1133814436 7 Left 1133814431 16:9185635-9185657 CCTGAAACATGTTTCTGAACCTG No data
Right 1133814436 16:9185665-9185687 TAATTGTTCCTTTTGACTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133814431 Original CRISPR CAGGTTCAGAAACATGTTTC AGG (reversed) Intergenic
No off target data available for this crispr