ID: 1133815434

View in Genome Browser
Species Human (GRCh38)
Location 16:9193980-9194002
Sequence TTGCAGATGTGATTAAGTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133815434_1133815439 21 Left 1133815434 16:9193980-9194002 CCATAACTTAATCACATCTGCAA No data
Right 1133815439 16:9194024-9194046 TGACATATACACAGGTTCTGGGG No data
1133815434_1133815438 20 Left 1133815434 16:9193980-9194002 CCATAACTTAATCACATCTGCAA No data
Right 1133815438 16:9194023-9194045 CTGACATATACACAGGTTCTGGG No data
1133815434_1133815437 19 Left 1133815434 16:9193980-9194002 CCATAACTTAATCACATCTGCAA No data
Right 1133815437 16:9194022-9194044 ACTGACATATACACAGGTTCTGG No data
1133815434_1133815436 13 Left 1133815434 16:9193980-9194002 CCATAACTTAATCACATCTGCAA No data
Right 1133815436 16:9194016-9194038 GTGTAAACTGACATATACACAGG No data
1133815434_1133815440 27 Left 1133815434 16:9193980-9194002 CCATAACTTAATCACATCTGCAA No data
Right 1133815440 16:9194030-9194052 ATACACAGGTTCTGGGGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133815434 Original CRISPR TTGCAGATGTGATTAAGTTA TGG (reversed) Intergenic