ID: 1133815436

View in Genome Browser
Species Human (GRCh38)
Location 16:9194016-9194038
Sequence GTGTAAACTGACATATACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133815434_1133815436 13 Left 1133815434 16:9193980-9194002 CCATAACTTAATCACATCTGCAA No data
Right 1133815436 16:9194016-9194038 GTGTAAACTGACATATACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133815436 Original CRISPR GTGTAAACTGACATATACAC AGG Intergenic