ID: 1133815438

View in Genome Browser
Species Human (GRCh38)
Location 16:9194023-9194045
Sequence CTGACATATACACAGGTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133815434_1133815438 20 Left 1133815434 16:9193980-9194002 CCATAACTTAATCACATCTGCAA No data
Right 1133815438 16:9194023-9194045 CTGACATATACACAGGTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133815438 Original CRISPR CTGACATATACACAGGTTCT GGG Intergenic