ID: 1133818612

View in Genome Browser
Species Human (GRCh38)
Location 16:9216721-9216743
Sequence GTCTGGCTGGACCAAGGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133818608_1133818612 -10 Left 1133818608 16:9216708-9216730 CCACCAGTGTTCTGTCTGGCTGG No data
Right 1133818612 16:9216721-9216743 GTCTGGCTGGACCAAGGAGTTGG No data
1133818606_1133818612 1 Left 1133818606 16:9216697-9216719 CCATGATGTGTCCACCAGTGTTC No data
Right 1133818612 16:9216721-9216743 GTCTGGCTGGACCAAGGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133818612 Original CRISPR GTCTGGCTGGACCAAGGAGT TGG Intergenic
No off target data available for this crispr