ID: 1133821673

View in Genome Browser
Species Human (GRCh38)
Location 16:9242726-9242748
Sequence CCTCAGGCTCCACAAAAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133821673_1133821681 8 Left 1133821673 16:9242726-9242748 CCAGGTTTTTGTGGAGCCTGAGG No data
Right 1133821681 16:9242757-9242779 ATTTAGGGGGGTCTTCCTTAAGG No data
1133821673_1133821679 -5 Left 1133821673 16:9242726-9242748 CCAGGTTTTTGTGGAGCCTGAGG No data
Right 1133821679 16:9242744-9242766 TGAGGCTTATACAATTTAGGGGG No data
1133821673_1133821675 -8 Left 1133821673 16:9242726-9242748 CCAGGTTTTTGTGGAGCCTGAGG No data
Right 1133821675 16:9242741-9242763 GCCTGAGGCTTATACAATTTAGG 0: 2
1: 10
2: 31
3: 78
4: 224
1133821673_1133821678 -6 Left 1133821673 16:9242726-9242748 CCAGGTTTTTGTGGAGCCTGAGG No data
Right 1133821678 16:9242743-9242765 CTGAGGCTTATACAATTTAGGGG No data
1133821673_1133821680 -4 Left 1133821673 16:9242726-9242748 CCAGGTTTTTGTGGAGCCTGAGG No data
Right 1133821680 16:9242745-9242767 GAGGCTTATACAATTTAGGGGGG No data
1133821673_1133821677 -7 Left 1133821673 16:9242726-9242748 CCAGGTTTTTGTGGAGCCTGAGG No data
Right 1133821677 16:9242742-9242764 CCTGAGGCTTATACAATTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133821673 Original CRISPR CCTCAGGCTCCACAAAAACC TGG (reversed) Intergenic
No off target data available for this crispr