ID: 1133821680

View in Genome Browser
Species Human (GRCh38)
Location 16:9242745-9242767
Sequence GAGGCTTATACAATTTAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133821673_1133821680 -4 Left 1133821673 16:9242726-9242748 CCAGGTTTTTGTGGAGCCTGAGG No data
Right 1133821680 16:9242745-9242767 GAGGCTTATACAATTTAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133821680 Original CRISPR GAGGCTTATACAATTTAGGG GGG Intergenic
No off target data available for this crispr