ID: 1133824525

View in Genome Browser
Species Human (GRCh38)
Location 16:9266006-9266028
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133824525_1133824527 -8 Left 1133824525 16:9266006-9266028 CCCTTGTATCTGTAGATTCATGT No data
Right 1133824527 16:9266021-9266043 ATTCATGTCTTTACTAGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133824525 Original CRISPR ACATGAATCTACAGATACAA GGG (reversed) Intergenic
No off target data available for this crispr