ID: 1133824526

View in Genome Browser
Species Human (GRCh38)
Location 16:9266007-9266029
Sequence GACATGAATCTACAGATACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133824526_1133824527 -9 Left 1133824526 16:9266007-9266029 CCTTGTATCTGTAGATTCATGTC No data
Right 1133824527 16:9266021-9266043 ATTCATGTCTTTACTAGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133824526 Original CRISPR GACATGAATCTACAGATACA AGG (reversed) Intergenic
No off target data available for this crispr