ID: 1133826239

View in Genome Browser
Species Human (GRCh38)
Location 16:9280685-9280707
Sequence GCCAAATGTCCCCTGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133826239_1133826245 18 Left 1133826239 16:9280685-9280707 CCCACCTCCAGGGGACATTTGGC No data
Right 1133826245 16:9280726-9280748 TGGTTGACATAACTTGCTGCTGG No data
1133826239_1133826243 -2 Left 1133826239 16:9280685-9280707 CCCACCTCCAGGGGACATTTGGC No data
Right 1133826243 16:9280706-9280728 GCCATATCTAGAGACATTTTTGG No data
1133826239_1133826246 30 Left 1133826239 16:9280685-9280707 CCCACCTCCAGGGGACATTTGGC No data
Right 1133826246 16:9280738-9280760 CTTGCTGCTGGCATATGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133826239 Original CRISPR GCCAAATGTCCCCTGGAGGT GGG (reversed) Intergenic
No off target data available for this crispr