ID: 1133826240

View in Genome Browser
Species Human (GRCh38)
Location 16:9280686-9280708
Sequence GGCCAAATGTCCCCTGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133826240_1133826243 -3 Left 1133826240 16:9280686-9280708 CCACCTCCAGGGGACATTTGGCC No data
Right 1133826243 16:9280706-9280728 GCCATATCTAGAGACATTTTTGG No data
1133826240_1133826247 30 Left 1133826240 16:9280686-9280708 CCACCTCCAGGGGACATTTGGCC No data
Right 1133826247 16:9280739-9280761 TTGCTGCTGGCATATGTAGTGGG No data
1133826240_1133826245 17 Left 1133826240 16:9280686-9280708 CCACCTCCAGGGGACATTTGGCC No data
Right 1133826245 16:9280726-9280748 TGGTTGACATAACTTGCTGCTGG No data
1133826240_1133826246 29 Left 1133826240 16:9280686-9280708 CCACCTCCAGGGGACATTTGGCC No data
Right 1133826246 16:9280738-9280760 CTTGCTGCTGGCATATGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133826240 Original CRISPR GGCCAAATGTCCCCTGGAGG TGG (reversed) Intergenic
No off target data available for this crispr