ID: 1133826241

View in Genome Browser
Species Human (GRCh38)
Location 16:9280689-9280711
Sequence TATGGCCAAATGTCCCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133826241_1133826243 -6 Left 1133826241 16:9280689-9280711 CCTCCAGGGGACATTTGGCCATA No data
Right 1133826243 16:9280706-9280728 GCCATATCTAGAGACATTTTTGG No data
1133826241_1133826245 14 Left 1133826241 16:9280689-9280711 CCTCCAGGGGACATTTGGCCATA No data
Right 1133826245 16:9280726-9280748 TGGTTGACATAACTTGCTGCTGG No data
1133826241_1133826247 27 Left 1133826241 16:9280689-9280711 CCTCCAGGGGACATTTGGCCATA No data
Right 1133826247 16:9280739-9280761 TTGCTGCTGGCATATGTAGTGGG No data
1133826241_1133826246 26 Left 1133826241 16:9280689-9280711 CCTCCAGGGGACATTTGGCCATA No data
Right 1133826246 16:9280738-9280760 CTTGCTGCTGGCATATGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133826241 Original CRISPR TATGGCCAAATGTCCCCTGG AGG (reversed) Intergenic
No off target data available for this crispr