ID: 1133826242

View in Genome Browser
Species Human (GRCh38)
Location 16:9280692-9280714
Sequence AGATATGGCCAAATGTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2497
Summary {0: 3, 1: 35, 2: 314, 3: 790, 4: 1355}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133826242_1133826248 30 Left 1133826242 16:9280692-9280714 CCAGGGGACATTTGGCCATATCT 0: 3
1: 35
2: 314
3: 790
4: 1355
Right 1133826248 16:9280745-9280767 CTGGCATATGTAGTGGGTAGAGG No data
1133826242_1133826246 23 Left 1133826242 16:9280692-9280714 CCAGGGGACATTTGGCCATATCT 0: 3
1: 35
2: 314
3: 790
4: 1355
Right 1133826246 16:9280738-9280760 CTTGCTGCTGGCATATGTAGTGG No data
1133826242_1133826243 -9 Left 1133826242 16:9280692-9280714 CCAGGGGACATTTGGCCATATCT 0: 3
1: 35
2: 314
3: 790
4: 1355
Right 1133826243 16:9280706-9280728 GCCATATCTAGAGACATTTTTGG No data
1133826242_1133826245 11 Left 1133826242 16:9280692-9280714 CCAGGGGACATTTGGCCATATCT 0: 3
1: 35
2: 314
3: 790
4: 1355
Right 1133826245 16:9280726-9280748 TGGTTGACATAACTTGCTGCTGG No data
1133826242_1133826247 24 Left 1133826242 16:9280692-9280714 CCAGGGGACATTTGGCCATATCT 0: 3
1: 35
2: 314
3: 790
4: 1355
Right 1133826247 16:9280739-9280761 TTGCTGCTGGCATATGTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133826242 Original CRISPR AGATATGGCCAAATGTCCCC TGG (reversed) Intergenic
Too many off-targets to display for this crispr