ID: 1133826244

View in Genome Browser
Species Human (GRCh38)
Location 16:9280707-9280729
Sequence ACCAAAAATGTCTCTAGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133826244_1133826247 9 Left 1133826244 16:9280707-9280729 CCATATCTAGAGACATTTTTGGT No data
Right 1133826247 16:9280739-9280761 TTGCTGCTGGCATATGTAGTGGG No data
1133826244_1133826251 21 Left 1133826244 16:9280707-9280729 CCATATCTAGAGACATTTTTGGT No data
Right 1133826251 16:9280751-9280773 TATGTAGTGGGTAGAGGCTGGGG No data
1133826244_1133826250 20 Left 1133826244 16:9280707-9280729 CCATATCTAGAGACATTTTTGGT No data
Right 1133826250 16:9280750-9280772 ATATGTAGTGGGTAGAGGCTGGG No data
1133826244_1133826245 -4 Left 1133826244 16:9280707-9280729 CCATATCTAGAGACATTTTTGGT No data
Right 1133826245 16:9280726-9280748 TGGTTGACATAACTTGCTGCTGG No data
1133826244_1133826249 19 Left 1133826244 16:9280707-9280729 CCATATCTAGAGACATTTTTGGT No data
Right 1133826249 16:9280749-9280771 CATATGTAGTGGGTAGAGGCTGG No data
1133826244_1133826248 15 Left 1133826244 16:9280707-9280729 CCATATCTAGAGACATTTTTGGT No data
Right 1133826248 16:9280745-9280767 CTGGCATATGTAGTGGGTAGAGG No data
1133826244_1133826246 8 Left 1133826244 16:9280707-9280729 CCATATCTAGAGACATTTTTGGT No data
Right 1133826246 16:9280738-9280760 CTTGCTGCTGGCATATGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133826244 Original CRISPR ACCAAAAATGTCTCTAGATA TGG (reversed) Intergenic
No off target data available for this crispr