ID: 1133826245

View in Genome Browser
Species Human (GRCh38)
Location 16:9280726-9280748
Sequence TGGTTGACATAACTTGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133826240_1133826245 17 Left 1133826240 16:9280686-9280708 CCACCTCCAGGGGACATTTGGCC No data
Right 1133826245 16:9280726-9280748 TGGTTGACATAACTTGCTGCTGG No data
1133826242_1133826245 11 Left 1133826242 16:9280692-9280714 CCAGGGGACATTTGGCCATATCT 0: 3
1: 35
2: 314
3: 790
4: 1355
Right 1133826245 16:9280726-9280748 TGGTTGACATAACTTGCTGCTGG No data
1133826239_1133826245 18 Left 1133826239 16:9280685-9280707 CCCACCTCCAGGGGACATTTGGC No data
Right 1133826245 16:9280726-9280748 TGGTTGACATAACTTGCTGCTGG No data
1133826244_1133826245 -4 Left 1133826244 16:9280707-9280729 CCATATCTAGAGACATTTTTGGT No data
Right 1133826245 16:9280726-9280748 TGGTTGACATAACTTGCTGCTGG No data
1133826241_1133826245 14 Left 1133826241 16:9280689-9280711 CCTCCAGGGGACATTTGGCCATA No data
Right 1133826245 16:9280726-9280748 TGGTTGACATAACTTGCTGCTGG No data
1133826237_1133826245 19 Left 1133826237 16:9280684-9280706 CCCCACCTCCAGGGGACATTTGG No data
Right 1133826245 16:9280726-9280748 TGGTTGACATAACTTGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133826245 Original CRISPR TGGTTGACATAACTTGCTGC TGG Intergenic
No off target data available for this crispr