ID: 1133826248

View in Genome Browser
Species Human (GRCh38)
Location 16:9280745-9280767
Sequence CTGGCATATGTAGTGGGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133826242_1133826248 30 Left 1133826242 16:9280692-9280714 CCAGGGGACATTTGGCCATATCT 0: 3
1: 35
2: 314
3: 790
4: 1355
Right 1133826248 16:9280745-9280767 CTGGCATATGTAGTGGGTAGAGG No data
1133826244_1133826248 15 Left 1133826244 16:9280707-9280729 CCATATCTAGAGACATTTTTGGT No data
Right 1133826248 16:9280745-9280767 CTGGCATATGTAGTGGGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133826248 Original CRISPR CTGGCATATGTAGTGGGTAG AGG Intergenic
No off target data available for this crispr