ID: 1133826249

View in Genome Browser
Species Human (GRCh38)
Location 16:9280749-9280771
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133826244_1133826249 19 Left 1133826244 16:9280707-9280729 CCATATCTAGAGACATTTTTGGT No data
Right 1133826249 16:9280749-9280771 CATATGTAGTGGGTAGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133826249 Original CRISPR CATATGTAGTGGGTAGAGGC TGG Intergenic
No off target data available for this crispr