ID: 1133831332

View in Genome Browser
Species Human (GRCh38)
Location 16:9326182-9326204
Sequence GCTGCTATGAAGATTAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133831332_1133831338 1 Left 1133831332 16:9326182-9326204 CCTTCTTTAATCTTCATAGCAGC No data
Right 1133831338 16:9326206-9326228 CTCTGAGGTAGGTGCTGGTAAGG No data
1133831332_1133831335 -4 Left 1133831332 16:9326182-9326204 CCTTCTTTAATCTTCATAGCAGC No data
Right 1133831335 16:9326201-9326223 CAGCCCTCTGAGGTAGGTGCTGG No data
1133831332_1133831339 14 Left 1133831332 16:9326182-9326204 CCTTCTTTAATCTTCATAGCAGC No data
Right 1133831339 16:9326219-9326241 GCTGGTAAGGTCTCCAGATGAGG No data
1133831332_1133831334 -10 Left 1133831332 16:9326182-9326204 CCTTCTTTAATCTTCATAGCAGC No data
Right 1133831334 16:9326195-9326217 TCATAGCAGCCCTCTGAGGTAGG No data
1133831332_1133831340 23 Left 1133831332 16:9326182-9326204 CCTTCTTTAATCTTCATAGCAGC No data
Right 1133831340 16:9326228-9326250 GTCTCCAGATGAGGAAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133831332 Original CRISPR GCTGCTATGAAGATTAAAGA AGG (reversed) Intergenic
No off target data available for this crispr