ID: 1133832585

View in Genome Browser
Species Human (GRCh38)
Location 16:9337787-9337809
Sequence GTGGGTATTCAGCTCAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133832585_1133832596 30 Left 1133832585 16:9337787-9337809 CCATGTCTGAGCTGAATACCCAC No data
Right 1133832596 16:9337840-9337862 ACCAAGCAGTGTCAGAGTCTTGG No data
1133832585_1133832591 -5 Left 1133832585 16:9337787-9337809 CCATGTCTGAGCTGAATACCCAC No data
Right 1133832591 16:9337805-9337827 CCCACCGGGTGCCCTTGGCTGGG No data
1133832585_1133832589 -6 Left 1133832585 16:9337787-9337809 CCATGTCTGAGCTGAATACCCAC No data
Right 1133832589 16:9337804-9337826 ACCCACCGGGTGCCCTTGGCTGG No data
1133832585_1133832588 -10 Left 1133832585 16:9337787-9337809 CCATGTCTGAGCTGAATACCCAC No data
Right 1133832588 16:9337800-9337822 GAATACCCACCGGGTGCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133832585 Original CRISPR GTGGGTATTCAGCTCAGACA TGG (reversed) Intergenic
No off target data available for this crispr