ID: 1133834304

View in Genome Browser
Species Human (GRCh38)
Location 16:9352328-9352350
Sequence AGACAGAGTGCAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133834304_1133834312 26 Left 1133834304 16:9352328-9352350 CCCACAATCACTGCACTCTGTCT No data
Right 1133834312 16:9352377-9352399 ACACCACAGTGCAGCTGCTGGGG No data
1133834304_1133834310 24 Left 1133834304 16:9352328-9352350 CCCACAATCACTGCACTCTGTCT No data
Right 1133834310 16:9352375-9352397 CCACACCACAGTGCAGCTGCTGG No data
1133834304_1133834313 27 Left 1133834304 16:9352328-9352350 CCCACAATCACTGCACTCTGTCT No data
Right 1133834313 16:9352378-9352400 CACCACAGTGCAGCTGCTGGGGG No data
1133834304_1133834311 25 Left 1133834304 16:9352328-9352350 CCCACAATCACTGCACTCTGTCT No data
Right 1133834311 16:9352376-9352398 CACACCACAGTGCAGCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133834304 Original CRISPR AGACAGAGTGCAGTGATTGT GGG (reversed) Intergenic
No off target data available for this crispr