ID: 1133834307

View in Genome Browser
Species Human (GRCh38)
Location 16:9352353-9352375
Sequence GAGAGAAGATTTGTGTGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133834307_1133834311 0 Left 1133834307 16:9352353-9352375 CCCAAACACACAAATCTTCTCTC No data
Right 1133834311 16:9352376-9352398 CACACCACAGTGCAGCTGCTGGG No data
1133834307_1133834316 7 Left 1133834307 16:9352353-9352375 CCCAAACACACAAATCTTCTCTC No data
Right 1133834316 16:9352383-9352405 CAGTGCAGCTGCTGGGGGTTGGG No data
1133834307_1133834313 2 Left 1133834307 16:9352353-9352375 CCCAAACACACAAATCTTCTCTC No data
Right 1133834313 16:9352378-9352400 CACCACAGTGCAGCTGCTGGGGG No data
1133834307_1133834315 6 Left 1133834307 16:9352353-9352375 CCCAAACACACAAATCTTCTCTC No data
Right 1133834315 16:9352382-9352404 ACAGTGCAGCTGCTGGGGGTTGG No data
1133834307_1133834310 -1 Left 1133834307 16:9352353-9352375 CCCAAACACACAAATCTTCTCTC No data
Right 1133834310 16:9352375-9352397 CCACACCACAGTGCAGCTGCTGG No data
1133834307_1133834318 17 Left 1133834307 16:9352353-9352375 CCCAAACACACAAATCTTCTCTC No data
Right 1133834318 16:9352393-9352415 GCTGGGGGTTGGGAGAGGAGTGG No data
1133834307_1133834312 1 Left 1133834307 16:9352353-9352375 CCCAAACACACAAATCTTCTCTC No data
Right 1133834312 16:9352377-9352399 ACACCACAGTGCAGCTGCTGGGG No data
1133834307_1133834317 12 Left 1133834307 16:9352353-9352375 CCCAAACACACAAATCTTCTCTC No data
Right 1133834317 16:9352388-9352410 CAGCTGCTGGGGGTTGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133834307 Original CRISPR GAGAGAAGATTTGTGTGTTT GGG (reversed) Intergenic
No off target data available for this crispr