ID: 1133834308

View in Genome Browser
Species Human (GRCh38)
Location 16:9352354-9352376
Sequence GGAGAGAAGATTTGTGTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133834308_1133834316 6 Left 1133834308 16:9352354-9352376 CCAAACACACAAATCTTCTCTCC No data
Right 1133834316 16:9352383-9352405 CAGTGCAGCTGCTGGGGGTTGGG No data
1133834308_1133834318 16 Left 1133834308 16:9352354-9352376 CCAAACACACAAATCTTCTCTCC No data
Right 1133834318 16:9352393-9352415 GCTGGGGGTTGGGAGAGGAGTGG No data
1133834308_1133834315 5 Left 1133834308 16:9352354-9352376 CCAAACACACAAATCTTCTCTCC No data
Right 1133834315 16:9352382-9352404 ACAGTGCAGCTGCTGGGGGTTGG No data
1133834308_1133834310 -2 Left 1133834308 16:9352354-9352376 CCAAACACACAAATCTTCTCTCC No data
Right 1133834310 16:9352375-9352397 CCACACCACAGTGCAGCTGCTGG No data
1133834308_1133834311 -1 Left 1133834308 16:9352354-9352376 CCAAACACACAAATCTTCTCTCC No data
Right 1133834311 16:9352376-9352398 CACACCACAGTGCAGCTGCTGGG No data
1133834308_1133834312 0 Left 1133834308 16:9352354-9352376 CCAAACACACAAATCTTCTCTCC No data
Right 1133834312 16:9352377-9352399 ACACCACAGTGCAGCTGCTGGGG No data
1133834308_1133834313 1 Left 1133834308 16:9352354-9352376 CCAAACACACAAATCTTCTCTCC No data
Right 1133834313 16:9352378-9352400 CACCACAGTGCAGCTGCTGGGGG No data
1133834308_1133834317 11 Left 1133834308 16:9352354-9352376 CCAAACACACAAATCTTCTCTCC No data
Right 1133834317 16:9352388-9352410 CAGCTGCTGGGGGTTGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133834308 Original CRISPR GGAGAGAAGATTTGTGTGTT TGG (reversed) Intergenic
No off target data available for this crispr