ID: 1133834311

View in Genome Browser
Species Human (GRCh38)
Location 16:9352376-9352398
Sequence CACACCACAGTGCAGCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133834305_1133834311 24 Left 1133834305 16:9352329-9352351 CCACAATCACTGCACTCTGTCTT No data
Right 1133834311 16:9352376-9352398 CACACCACAGTGCAGCTGCTGGG No data
1133834303_1133834311 26 Left 1133834303 16:9352327-9352349 CCCCACAATCACTGCACTCTGTC No data
Right 1133834311 16:9352376-9352398 CACACCACAGTGCAGCTGCTGGG No data
1133834308_1133834311 -1 Left 1133834308 16:9352354-9352376 CCAAACACACAAATCTTCTCTCC No data
Right 1133834311 16:9352376-9352398 CACACCACAGTGCAGCTGCTGGG No data
1133834307_1133834311 0 Left 1133834307 16:9352353-9352375 CCCAAACACACAAATCTTCTCTC No data
Right 1133834311 16:9352376-9352398 CACACCACAGTGCAGCTGCTGGG No data
1133834306_1133834311 1 Left 1133834306 16:9352352-9352374 CCCCAAACACACAAATCTTCTCT No data
Right 1133834311 16:9352376-9352398 CACACCACAGTGCAGCTGCTGGG No data
1133834304_1133834311 25 Left 1133834304 16:9352328-9352350 CCCACAATCACTGCACTCTGTCT No data
Right 1133834311 16:9352376-9352398 CACACCACAGTGCAGCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133834311 Original CRISPR CACACCACAGTGCAGCTGCT GGG Intergenic
No off target data available for this crispr