ID: 1133837313

View in Genome Browser
Species Human (GRCh38)
Location 16:9378517-9378539
Sequence CTGTGGATAAAGAGTTAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133837311_1133837313 -5 Left 1133837311 16:9378499-9378521 CCTCATGCTTGGGAAACTCTGTG No data
Right 1133837313 16:9378517-9378539 CTGTGGATAAAGAGTTAACAAGG No data
1133837310_1133837313 -4 Left 1133837310 16:9378498-9378520 CCCTCATGCTTGGGAAACTCTGT No data
Right 1133837313 16:9378517-9378539 CTGTGGATAAAGAGTTAACAAGG No data
1133837308_1133837313 2 Left 1133837308 16:9378492-9378514 CCCAGACCCTCATGCTTGGGAAA No data
Right 1133837313 16:9378517-9378539 CTGTGGATAAAGAGTTAACAAGG No data
1133837304_1133837313 29 Left 1133837304 16:9378465-9378487 CCACAGGTTCATTAGCTATGGCT No data
Right 1133837313 16:9378517-9378539 CTGTGGATAAAGAGTTAACAAGG No data
1133837309_1133837313 1 Left 1133837309 16:9378493-9378515 CCAGACCCTCATGCTTGGGAAAC No data
Right 1133837313 16:9378517-9378539 CTGTGGATAAAGAGTTAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133837313 Original CRISPR CTGTGGATAAAGAGTTAACA AGG Intergenic
No off target data available for this crispr