ID: 1133838714

View in Genome Browser
Species Human (GRCh38)
Location 16:9389118-9389140
Sequence GGTCCTGCATGGTCTGACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133838714_1133838718 16 Left 1133838714 16:9389118-9389140 CCAAGGTCAGACCATGCAGGACC No data
Right 1133838718 16:9389157-9389179 TCTGTTTTCTAAATGCCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133838714 Original CRISPR GGTCCTGCATGGTCTGACCT TGG (reversed) Intergenic
No off target data available for this crispr