ID: 1133844238

View in Genome Browser
Species Human (GRCh38)
Location 16:9439301-9439323
Sequence TCTCCATTACCAAGAACCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133844235_1133844238 4 Left 1133844235 16:9439274-9439296 CCTGCACTGCATGGGGCTCTGTG No data
Right 1133844238 16:9439301-9439323 TCTCCATTACCAAGAACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133844238 Original CRISPR TCTCCATTACCAAGAACCCC AGG Intergenic
No off target data available for this crispr