ID: 1133845505

View in Genome Browser
Species Human (GRCh38)
Location 16:9449920-9449942
Sequence ATGATATTTAATGAGGACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133845505_1133845507 -2 Left 1133845505 16:9449920-9449942 CCTGAGTCCTCATTAAATATCAT No data
Right 1133845507 16:9449941-9449963 ATGTTCACCATTTAGATTTACGG No data
1133845505_1133845509 22 Left 1133845505 16:9449920-9449942 CCTGAGTCCTCATTAAATATCAT No data
Right 1133845509 16:9449965-9449987 ATAGCATTTCAGAAGTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133845505 Original CRISPR ATGATATTTAATGAGGACTC AGG (reversed) Intergenic
No off target data available for this crispr