ID: 1133845506

View in Genome Browser
Species Human (GRCh38)
Location 16:9449927-9449949
Sequence GGTGAACATGATATTTAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133845506_1133845507 -9 Left 1133845506 16:9449927-9449949 CCTCATTAAATATCATGTTCACC No data
Right 1133845507 16:9449941-9449963 ATGTTCACCATTTAGATTTACGG No data
1133845506_1133845509 15 Left 1133845506 16:9449927-9449949 CCTCATTAAATATCATGTTCACC No data
Right 1133845509 16:9449965-9449987 ATAGCATTTCAGAAGTTCCATGG No data
1133845506_1133845510 28 Left 1133845506 16:9449927-9449949 CCTCATTAAATATCATGTTCACC No data
Right 1133845510 16:9449978-9450000 AGTTCCATGGTGTTTCCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133845506 Original CRISPR GGTGAACATGATATTTAATG AGG (reversed) Intergenic
No off target data available for this crispr