ID: 1133845507

View in Genome Browser
Species Human (GRCh38)
Location 16:9449941-9449963
Sequence ATGTTCACCATTTAGATTTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133845506_1133845507 -9 Left 1133845506 16:9449927-9449949 CCTCATTAAATATCATGTTCACC No data
Right 1133845507 16:9449941-9449963 ATGTTCACCATTTAGATTTACGG No data
1133845505_1133845507 -2 Left 1133845505 16:9449920-9449942 CCTGAGTCCTCATTAAATATCAT No data
Right 1133845507 16:9449941-9449963 ATGTTCACCATTTAGATTTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133845507 Original CRISPR ATGTTCACCATTTAGATTTA CGG Intergenic
No off target data available for this crispr