ID: 1133846736

View in Genome Browser
Species Human (GRCh38)
Location 16:9461349-9461371
Sequence TGATGCAATGAGAAGGTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133846736_1133846739 7 Left 1133846736 16:9461349-9461371 CCCAGAACCTTCTCATTGCATCA No data
Right 1133846739 16:9461379-9461401 TTCTCTGAGAGAAAGAAATCTGG No data
1133846736_1133846740 22 Left 1133846736 16:9461349-9461371 CCCAGAACCTTCTCATTGCATCA No data
Right 1133846740 16:9461394-9461416 AAATCTGGTTTTTCCATTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133846736 Original CRISPR TGATGCAATGAGAAGGTTCT GGG (reversed) Intergenic
No off target data available for this crispr