ID: 1133855624

View in Genome Browser
Species Human (GRCh38)
Location 16:9546774-9546796
Sequence GGTTCTGTTAAGATGTAGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133855624_1133855632 11 Left 1133855624 16:9546774-9546796 CCCGACTACATCTTAACAGAACC No data
Right 1133855632 16:9546808-9546830 CATGTGAGGGGGCAGATAGGTGG No data
1133855624_1133855629 -1 Left 1133855624 16:9546774-9546796 CCCGACTACATCTTAACAGAACC No data
Right 1133855629 16:9546796-9546818 CGTTCTGACACTCATGTGAGGGG No data
1133855624_1133855634 13 Left 1133855624 16:9546774-9546796 CCCGACTACATCTTAACAGAACC No data
Right 1133855634 16:9546810-9546832 TGTGAGGGGGCAGATAGGTGGGG No data
1133855624_1133855635 20 Left 1133855624 16:9546774-9546796 CCCGACTACATCTTAACAGAACC No data
Right 1133855635 16:9546817-9546839 GGGCAGATAGGTGGGGAGCGAGG No data
1133855624_1133855633 12 Left 1133855624 16:9546774-9546796 CCCGACTACATCTTAACAGAACC No data
Right 1133855633 16:9546809-9546831 ATGTGAGGGGGCAGATAGGTGGG No data
1133855624_1133855626 -3 Left 1133855624 16:9546774-9546796 CCCGACTACATCTTAACAGAACC No data
Right 1133855626 16:9546794-9546816 ACCGTTCTGACACTCATGTGAGG No data
1133855624_1133855631 8 Left 1133855624 16:9546774-9546796 CCCGACTACATCTTAACAGAACC No data
Right 1133855631 16:9546805-9546827 ACTCATGTGAGGGGGCAGATAGG No data
1133855624_1133855630 0 Left 1133855624 16:9546774-9546796 CCCGACTACATCTTAACAGAACC No data
Right 1133855630 16:9546797-9546819 GTTCTGACACTCATGTGAGGGGG No data
1133855624_1133855628 -2 Left 1133855624 16:9546774-9546796 CCCGACTACATCTTAACAGAACC No data
Right 1133855628 16:9546795-9546817 CCGTTCTGACACTCATGTGAGGG No data
1133855624_1133855636 24 Left 1133855624 16:9546774-9546796 CCCGACTACATCTTAACAGAACC No data
Right 1133855636 16:9546821-9546843 AGATAGGTGGGGAGCGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133855624 Original CRISPR GGTTCTGTTAAGATGTAGTC GGG (reversed) Intergenic