ID: 1133856404

View in Genome Browser
Species Human (GRCh38)
Location 16:9553362-9553384
Sequence CCAACCAAAAATGAGTTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133856398_1133856404 5 Left 1133856398 16:9553334-9553356 CCTTTTCATAAACTTCTTCTCCA No data
Right 1133856404 16:9553362-9553384 CCAACCAAAAATGAGTTTTGGGG No data
1133856397_1133856404 6 Left 1133856397 16:9553333-9553355 CCCTTTTCATAAACTTCTTCTCC No data
Right 1133856404 16:9553362-9553384 CCAACCAAAAATGAGTTTTGGGG No data
1133856396_1133856404 24 Left 1133856396 16:9553315-9553337 CCTGCGCTGTTAATTATGCCCTT No data
Right 1133856404 16:9553362-9553384 CCAACCAAAAATGAGTTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133856404 Original CRISPR CCAACCAAAAATGAGTTTTG GGG Intergenic
No off target data available for this crispr