ID: 1133857881

View in Genome Browser
Species Human (GRCh38)
Location 16:9566513-9566535
Sequence AAAATCAGTCTAGCAAAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133857876_1133857881 18 Left 1133857876 16:9566472-9566494 CCGCAGCCACTTTGTGACAGCCT No data
Right 1133857881 16:9566513-9566535 AAAATCAGTCTAGCAAAAGGAGG No data
1133857877_1133857881 12 Left 1133857877 16:9566478-9566500 CCACTTTGTGACAGCCTGAGAAT No data
Right 1133857881 16:9566513-9566535 AAAATCAGTCTAGCAAAAGGAGG No data
1133857878_1133857881 -2 Left 1133857878 16:9566492-9566514 CCTGAGAATGAATCCAGCGCTAA No data
Right 1133857881 16:9566513-9566535 AAAATCAGTCTAGCAAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133857881 Original CRISPR AAAATCAGTCTAGCAAAAGG AGG Intergenic