ID: 1133866143

View in Genome Browser
Species Human (GRCh38)
Location 16:9645277-9645299
Sequence CTGAATTTACAGATAGGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133866143_1133866146 0 Left 1133866143 16:9645277-9645299 CCATTTCCTATCTGTAAATTCAG No data
Right 1133866146 16:9645300-9645322 GATAATACAATGTGACCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133866143 Original CRISPR CTGAATTTACAGATAGGAAA TGG (reversed) Intergenic
No off target data available for this crispr