ID: 1133870363

View in Genome Browser
Species Human (GRCh38)
Location 16:9680273-9680295
Sequence GGTGGTCTCTGATTTACATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133870363_1133870368 18 Left 1133870363 16:9680273-9680295 CCCTATGTAAATCAGAGACCACC No data
Right 1133870368 16:9680314-9680336 AAACCTCCTGCACTTCACCACGG No data
1133870363_1133870369 19 Left 1133870363 16:9680273-9680295 CCCTATGTAAATCAGAGACCACC No data
Right 1133870369 16:9680315-9680337 AACCTCCTGCACTTCACCACGGG No data
1133870363_1133870373 24 Left 1133870363 16:9680273-9680295 CCCTATGTAAATCAGAGACCACC No data
Right 1133870373 16:9680320-9680342 CCTGCACTTCACCACGGGGCTGG No data
1133870363_1133870370 20 Left 1133870363 16:9680273-9680295 CCCTATGTAAATCAGAGACCACC No data
Right 1133870370 16:9680316-9680338 ACCTCCTGCACTTCACCACGGGG No data
1133870363_1133870374 27 Left 1133870363 16:9680273-9680295 CCCTATGTAAATCAGAGACCACC No data
Right 1133870374 16:9680323-9680345 GCACTTCACCACGGGGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133870363 Original CRISPR GGTGGTCTCTGATTTACATA GGG (reversed) Intergenic
No off target data available for this crispr