ID: 1133870367

View in Genome Browser
Species Human (GRCh38)
Location 16:9680294-9680316
Sequence TTTTATAGATAAGCCTGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133870367_1133870378 17 Left 1133870367 16:9680294-9680316 CCTTCTCAGGCTTATCTATAAAA No data
Right 1133870378 16:9680334-9680356 CGGGGCTGGAGGACCGGCTCGGG No data
1133870367_1133870369 -2 Left 1133870367 16:9680294-9680316 CCTTCTCAGGCTTATCTATAAAA No data
Right 1133870369 16:9680315-9680337 AACCTCCTGCACTTCACCACGGG No data
1133870367_1133870368 -3 Left 1133870367 16:9680294-9680316 CCTTCTCAGGCTTATCTATAAAA No data
Right 1133870368 16:9680314-9680336 AAACCTCCTGCACTTCACCACGG No data
1133870367_1133870374 6 Left 1133870367 16:9680294-9680316 CCTTCTCAGGCTTATCTATAAAA No data
Right 1133870374 16:9680323-9680345 GCACTTCACCACGGGGCTGGAGG No data
1133870367_1133870370 -1 Left 1133870367 16:9680294-9680316 CCTTCTCAGGCTTATCTATAAAA No data
Right 1133870370 16:9680316-9680338 ACCTCCTGCACTTCACCACGGGG No data
1133870367_1133870377 16 Left 1133870367 16:9680294-9680316 CCTTCTCAGGCTTATCTATAAAA No data
Right 1133870377 16:9680333-9680355 ACGGGGCTGGAGGACCGGCTCGG No data
1133870367_1133870373 3 Left 1133870367 16:9680294-9680316 CCTTCTCAGGCTTATCTATAAAA No data
Right 1133870373 16:9680320-9680342 CCTGCACTTCACCACGGGGCTGG No data
1133870367_1133870375 11 Left 1133870367 16:9680294-9680316 CCTTCTCAGGCTTATCTATAAAA No data
Right 1133870375 16:9680328-9680350 TCACCACGGGGCTGGAGGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133870367 Original CRISPR TTTTATAGATAAGCCTGAGA AGG (reversed) Intergenic
No off target data available for this crispr