ID: 1133870373

View in Genome Browser
Species Human (GRCh38)
Location 16:9680320-9680342
Sequence CCTGCACTTCACCACGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133870364_1133870373 23 Left 1133870364 16:9680274-9680296 CCTATGTAAATCAGAGACCACCT No data
Right 1133870373 16:9680320-9680342 CCTGCACTTCACCACGGGGCTGG No data
1133870367_1133870373 3 Left 1133870367 16:9680294-9680316 CCTTCTCAGGCTTATCTATAAAA No data
Right 1133870373 16:9680320-9680342 CCTGCACTTCACCACGGGGCTGG No data
1133870366_1133870373 6 Left 1133870366 16:9680291-9680313 CCACCTTCTCAGGCTTATCTATA No data
Right 1133870373 16:9680320-9680342 CCTGCACTTCACCACGGGGCTGG No data
1133870363_1133870373 24 Left 1133870363 16:9680273-9680295 CCCTATGTAAATCAGAGACCACC No data
Right 1133870373 16:9680320-9680342 CCTGCACTTCACCACGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133870373 Original CRISPR CCTGCACTTCACCACGGGGC TGG Intergenic
No off target data available for this crispr