ID: 1133872934

View in Genome Browser
Species Human (GRCh38)
Location 16:9706415-9706437
Sequence CTCTTATCAGGAAGGAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 534
Summary {0: 24, 1: 53, 2: 69, 3: 63, 4: 325}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133872934_1133872937 -9 Left 1133872934 16:9706415-9706437 CCAGCATTCCTTCCTGATAAGAG 0: 24
1: 53
2: 69
3: 63
4: 325
Right 1133872937 16:9706429-9706451 TGATAAGAGACCACAGACCATGG No data
1133872934_1133872942 16 Left 1133872934 16:9706415-9706437 CCAGCATTCCTTCCTGATAAGAG 0: 24
1: 53
2: 69
3: 63
4: 325
Right 1133872942 16:9706454-9706476 TCATTCTGGCTGGTTTACAGAGG No data
1133872934_1133872939 2 Left 1133872934 16:9706415-9706437 CCAGCATTCCTTCCTGATAAGAG 0: 24
1: 53
2: 69
3: 63
4: 325
Right 1133872939 16:9706440-9706462 CACAGACCATGGACTCATTCTGG No data
1133872934_1133872940 6 Left 1133872934 16:9706415-9706437 CCAGCATTCCTTCCTGATAAGAG 0: 24
1: 53
2: 69
3: 63
4: 325
Right 1133872940 16:9706444-9706466 GACCATGGACTCATTCTGGCTGG No data
1133872934_1133872943 27 Left 1133872934 16:9706415-9706437 CCAGCATTCCTTCCTGATAAGAG 0: 24
1: 53
2: 69
3: 63
4: 325
Right 1133872943 16:9706465-9706487 GGTTTACAGAGGCTGCACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133872934 Original CRISPR CTCTTATCAGGAAGGAATGC TGG (reversed) Intergenic
900099540 1:955705-955727 CCCTTTTCAGGAAGGAAAGAAGG + Intronic
902193198 1:14778290-14778312 CTCTTACCAGGAAAGAATGCTGG + Intronic
902660596 1:17899307-17899329 TTTTTATCATGAAGGAATGTTGG - Intergenic
904341946 1:29841228-29841250 CTCTTATCAGGAAGGAATCCTGG - Intergenic
906056273 1:42920109-42920131 TTTTTATCAGGAATGAATGATGG - Intergenic
908469010 1:64423735-64423757 CTCTTATCAGGAAGGAATGCTGG - Intergenic
908496580 1:64700570-64700592 CTCTTGTCAGTAAGAAATGCTGG - Intergenic
909277610 1:73708444-73708466 CTCTCATCAGGAAGAAATGGTGG - Intergenic
909371005 1:74883420-74883442 TTTTTATCATGAAGGGATGCTGG - Intergenic
910043243 1:82880166-82880188 CTCTTACCAGGAAGCTTTGCAGG - Intergenic
910358876 1:86395410-86395432 CAGTTATCAGTAAGGAATCCAGG + Intronic
910776160 1:90877437-90877459 GTTTTATCATGAAAGAATGCTGG + Intergenic
910780397 1:90926136-90926158 CTCTTATCAGTAAGGAATGCTGG - Intronic
911511424 1:98811262-98811284 CTTTTATCATGAAGGGATGTTGG - Intergenic
911927088 1:103847342-103847364 CTCTTATTATGAATGTATGCTGG - Intergenic
912025913 1:105171879-105171901 CTCCTATCAGGAAGAAAGGGAGG + Intergenic
915059492 1:153169249-153169271 CTTTTATCAGGAAGGAACGTCGG - Intergenic
916436484 1:164782383-164782405 ATCTTATTGGGAAGGAATCCTGG + Intronic
916794945 1:168157732-168157754 TTTTTATCATGAAGGAATGTTGG + Intergenic
916872845 1:168936029-168936051 TTCTAATCATGAAGGGATGCTGG + Intergenic
916899351 1:169203642-169203664 CTCTAATCAGGAAGGAATGCTGG + Intronic
918484779 1:185017536-185017558 CTCTTGTTAAGAAGAAATGCTGG - Intergenic
919430988 1:197491460-197491482 CTTTTATCCTAAAGGAATGCTGG - Intergenic
920042260 1:203108457-203108479 TTTTTATCATGAAGGGATGCTGG - Intronic
920801035 1:209187743-209187765 CTCTTATCAGGAAGGAGTGCTGG + Intergenic
921259419 1:213372348-213372370 CACCTATCAGGCAGGAATGCAGG + Intergenic
921689874 1:218136138-218136160 CTCCTATCAGGAAGGAATAAAGG + Intergenic
922074870 1:222233640-222233662 TTCTTATCAGGAAGGAATGCTGG - Intergenic
922231321 1:223689375-223689397 CTCTTACCAGGAAGGAATGCTGG + Intergenic
924289841 1:242525143-242525165 CTATTTTCAGGGGGGAATGCTGG - Intergenic
1063254301 10:4309233-4309255 GTCTTATCAGGAAGGTGTGCTGG + Intergenic
1063521745 10:6747684-6747706 CTCTTATCAGGAAGCAGTGCTGG - Intergenic
1065177435 10:23092894-23092916 TTTTTATCAGGAAGGGATGTTGG - Intergenic
1065592125 10:27274272-27274294 CTTTTATTAGGAATGAATGTTGG + Intergenic
1065658231 10:27976086-27976108 CTTTTATTAGGAATGAATGTTGG - Intronic
1068366973 10:56064279-56064301 TTTTTATCTGGAAGGAATGCTGG + Intergenic
1068987935 10:63124138-63124160 CTATTATCAGGAAGGAATGCTGG + Intergenic
1069122445 10:64583956-64583978 TTTTTAACATGAAGGAATGCTGG + Intergenic
1070892904 10:79955276-79955298 TTCTGAGCAGGAAGGAAGGCTGG + Intronic
1070972670 10:80580427-80580449 CTCTTATCAGGAAGGAAGGCTGG + Intronic
1071387266 10:85133965-85133987 CTTTTACCTGGAAGGAAAGCAGG + Intergenic
1071740959 10:88357673-88357695 CACTTATTTGGAAGGAAAGCTGG - Intronic
1071894204 10:90047274-90047296 TTCTTGTCATGAAGGGATGCTGG + Intergenic
1072481471 10:95813476-95813498 CTCTTATCAGGCAGAAAAGATGG + Intronic
1073128032 10:101164416-101164438 CTCTGATCAGGAAGGGATATTGG + Intergenic
1073745180 10:106460301-106460323 ATTTTATCATGAAGAAATGCTGG + Intergenic
1073844834 10:107543566-107543588 TTCTTATAAAGAAGGAATCCAGG - Intergenic
1075386344 10:122058034-122058056 CTCTTGTGTGGAAGGAATGCTGG - Intronic
1079661080 11:23037306-23037328 CTTTTATCATGAAGGGATACTGG - Intergenic
1079945452 11:26735465-26735487 CTGTTATCATGAAGGAATGTTGG - Intergenic
1080128523 11:28766316-28766338 TTCTTAAGAGGAAGGAAGGCAGG - Intergenic
1080544469 11:33302222-33302244 TTCATTTCAGGAAGGAATGGAGG - Intronic
1081179034 11:39965275-39965297 CTCTTATCAGGAAGAAATGCTGG - Intergenic
1082650198 11:55781285-55781307 CTTTTATCATGAAGGGATGTTGG - Intergenic
1082705265 11:56487039-56487061 CTCTTATCAAGAAGGAATGCTGG - Intergenic
1082847192 11:57735887-57735909 CTCTTATCAGGAAGCAATGCTGG + Intronic
1083517782 11:63276715-63276737 CTCTTATCATGAAAGAATAAGGG + Intronic
1086576749 11:88347338-88347360 CTCTCATCAGGAAGGAATGCTGG + Intergenic
1088053975 11:105553164-105553186 CTGTTATCAGGAAGGAATGTTGG + Intergenic
1088194272 11:107258135-107258157 CTCTTACCAGGAAGAAATGCTGG + Intergenic
1088516596 11:110642484-110642506 TTCTTATCAGGAAGGGATGTTGG + Intronic
1088966802 11:114731092-114731114 CTTTTATCATGAAGGCATGTTGG + Intergenic
1090483783 11:127093203-127093225 TTTTTATCATGAAGGGATGCTGG - Intergenic
1090541538 11:127711700-127711722 CTCTCATCAGGAAGGACCGTTGG - Intergenic
1092080137 12:5709304-5709326 CTCCTAACAGGAAGAAAGGCTGG - Intronic
1092128589 12:6092678-6092700 CTCTTACCAGGAAGGAATGCTGG - Intronic
1092605110 12:10110229-10110251 TTTTTATCATAAAGGAATGCAGG - Intronic
1092643212 12:10539276-10539298 TTTTTATCATGAAGGGATGCTGG - Intergenic
1092861122 12:12719638-12719660 CTCTTGTCAGTAAGCAATCCAGG + Intronic
1093534248 12:20203394-20203416 CTTTTTTCAAGAAGCAATGCAGG - Intergenic
1094351450 12:29530409-29530431 TTCTTTCCAGGAAGAAATGCTGG - Intronic
1095144082 12:38703401-38703423 GTTTTATCAGGAAGGGATGCTGG - Intronic
1095829189 12:46565550-46565572 TTCTTATTATGAAGGGATGCTGG + Intergenic
1096416066 12:51414859-51414881 CTTTTATCATGAAAGAATGTTGG + Intronic
1096849205 12:54424779-54424801 CTCTGATCAGGTAGGAATCAGGG + Intergenic
1096920376 12:55078800-55078822 TTCTTATCATGAAGGGATGTTGG - Intergenic
1098410504 12:70177844-70177866 CTCTTCTTAAGAAGGAATGTTGG + Intergenic
1098935064 12:76469401-76469423 CTATTATCAGGTCGGATTGCAGG + Intronic
1099580817 12:84444864-84444886 TTGTTACCAGGAAGGAAGGCAGG + Intergenic
1099620789 12:85000637-85000659 CTCTTATTAAGAAGGAATGCAGG - Intergenic
1099820287 12:87700425-87700447 CTCTTGTAAGGCAGGACTGCTGG + Intergenic
1100716747 12:97313971-97313993 CTCTTATCAAAAAGGAATGCTGG + Intergenic
1100727410 12:97423245-97423267 CTCTTATCAGGCAAGAAAGAAGG - Intergenic
1101462751 12:104913447-104913469 CTCTTACCAGGAAGGAATCCTGG - Intronic
1101556664 12:105816573-105816595 CTCTTGTGAGGAAGGGATGAGGG + Intergenic
1101598895 12:106191284-106191306 CTCTAATCAGGAAGGAAAAGTGG + Intergenic
1104741751 12:131181670-131181692 CTTTTATCATAAAGGGATGCTGG - Intergenic
1106045809 13:26140441-26140463 CTTTTATCATGAAGGGATGTTGG - Intronic
1106379150 13:29219532-29219554 CTCTTGTTAGAAATGAATGCAGG - Intronic
1107019866 13:35740396-35740418 CTCTTATCAGGAAGGAATGCTGG - Intergenic
1107380858 13:39855320-39855342 CACTTATCAGGAAGGAATGCTGG - Intergenic
1107712958 13:43168792-43168814 CTCTTATCAGGAAGGAACGCTGG + Intergenic
1108921117 13:55675524-55675546 ATCTTAACAGGAAGGAATGCTGG + Intergenic
1109477269 13:62897584-62897606 TTGTTATCATGAAGGGATGCTGG + Intergenic
1111097923 13:83538852-83538874 CTCTTAGCAGAAAAGGATGCTGG - Intergenic
1111970668 13:94911916-94911938 CTTTTATCATGAAGGAATGTTGG - Intergenic
1112030120 13:95449134-95449156 CTGTGATCTGGAAGGAATGGAGG - Intronic
1112601820 13:100863478-100863500 CTTTTATCAAGAAAGACTGCTGG + Intergenic
1112766572 13:102752075-102752097 CTCTTATCAGGAAGGAATGCTGG - Intronic
1112960048 13:105112833-105112855 CTCTTATCTGGAAGAAATGCTGG - Intergenic
1113225190 13:108152013-108152035 CTCTTATCAGAAAGGACTGCTGG + Intergenic
1113701349 13:112390955-112390977 CTCTCACCAGGAAGGAATGCTGG + Intronic
1114129623 14:19775175-19775197 CTCTTATCAGGAAGCAATGCTGG - Intronic
1114232252 14:20793683-20793705 CTTTTATCAGAAATGAATGTGGG + Intergenic
1114717520 14:24843426-24843448 CCCTTAACAGGAGGGAAGGCAGG + Intronic
1114908825 14:27166510-27166532 CTCTCATCAGGCAGCAATGTTGG - Intergenic
1115239655 14:31241987-31242009 CTCTTTTCAGGAAAGAATGCTGG + Intergenic
1115263347 14:31475412-31475434 CTCTCATAAGGAAGAAATGCTGG - Intergenic
1115464749 14:33702814-33702836 CTCTTGTCAGTAAGGATTGAGGG + Intronic
1116149053 14:41115273-41115295 CTTTTATCATGAAGGGATGCTGG - Intergenic
1116222536 14:42107132-42107154 CTATTATCATGAAAGAATGTTGG + Intergenic
1116284052 14:42949489-42949511 CTTTTATCAAGAAAGAATGTTGG - Intergenic
1116493545 14:45534831-45534853 CTCTTATAAGGCAGGACTGATGG + Intergenic
1116501542 14:45629832-45629854 TTCTTTTCAGGAAGGTCTGCTGG + Intergenic
1116912003 14:50477674-50477696 TTTTTATCAGGAATGAATGTTGG + Intronic
1117199781 14:53377288-53377310 CTAATATCAGGAATGAAAGCGGG + Intergenic
1118808224 14:69256061-69256083 CTCTAAGCAGGAAAGAAGGCAGG - Intergenic
1119100212 14:71872362-71872384 CTCTGATCAGGATGGAAAGGGGG + Intergenic
1119104572 14:71912114-71912136 CTCTTATTAGAAAGAAATGCTGG + Intergenic
1120538205 14:85722849-85722871 CTCTTACCAGGAAGGAGTACTGG + Intergenic
1120737725 14:88072988-88073010 CTAGTATCAGGAATGAAAGCGGG + Intergenic
1121730286 14:96182039-96182061 CTCTTATTAGAAAGGAAGGAGGG - Intergenic
1122657165 14:103269819-103269841 CTCTTATCAGGAGGGGATGCTGG - Intergenic
1122994687 14:105256678-105256700 CTTTGATCAGGAAGGAAAGGTGG + Intronic
1202894592 14_KI270722v1_random:193199-193221 ATTTTATCATGAATGAATGCTGG + Intergenic
1123572899 15:21632925-21632947 CTCTTATCAGGAAGGAATGCTGG - Intergenic
1123609519 15:22075512-22075534 CTCTTATCAGGAAGGAATGCTGG - Intergenic
1123987043 15:25655153-25655175 CTGTTTTCAGGAAGAAATGCTGG - Intergenic
1124010919 15:25837900-25837922 CTCTTGGAAGGAAGGTATGCTGG + Intronic
1124100635 15:26689707-26689729 CCCCAAGCAGGAAGGAATGCTGG + Intronic
1124104465 15:26724533-26724555 CTCTTATCAGGAAAGAATGCTGG - Intronic
1124392560 15:29272915-29272937 CTTTTACCAGGAAGAACTGCTGG + Intronic
1124940410 15:34212472-34212494 CTCTCAGAAGGAAGGAATGAAGG - Intergenic
1125465644 15:39949184-39949206 GTCTTTTCATGAAGAAATGCTGG + Exonic
1126206483 15:46050958-46050980 CTTTTATCATGAAGGTATGTTGG + Intergenic
1126301465 15:47201751-47201773 CCCACCTCAGGAAGGAATGCTGG + Intronic
1126997122 15:54457075-54457097 TTTTAATCAGGAAGGGATGCTGG + Intronic
1127780616 15:62311082-62311104 GTTTTATCATGAAGGAATGTTGG - Intergenic
1129767753 15:78180997-78181019 CTCTTACCAGCCAGGCATGCCGG + Intronic
1129792044 15:78347995-78348017 CTACTTTCAGGAAGGGATGCAGG + Exonic
1129983418 15:79895616-79895638 CTATTATGAGGAAGCATTGCTGG - Intronic
1130345162 15:83037483-83037505 CTTTTATCATGAAGAGATGCTGG - Intronic
1131409991 15:92199627-92199649 CTCTTATCAGGAAGGAATGCTGG + Intergenic
1131451803 15:92547537-92547559 CTCATAACAGGAAGGAATGAAGG + Intergenic
1132021046 15:98363173-98363195 CACTTACCAGGAAGGAAGGAAGG + Intergenic
1202981761 15_KI270727v1_random:367297-367319 CTCTTATCAGGAAGGAATGCTGG - Intergenic
1133061842 16:3179966-3179988 CTCTAATCAGAGAGGAAGGCAGG + Intergenic
1133872934 16:9706415-9706437 CTCTTATCAGGAAGGAATGCTGG - Intergenic
1135201204 16:20439124-20439146 CTGTTAACAGATAGGAATGCTGG + Intronic
1135217904 16:20588740-20588762 CTGTTAACAGATAGGAATGCTGG - Intergenic
1135762945 16:25152155-25152177 GTCTCATCAGGAAGGAATGCTGG + Intronic
1135918599 16:26627674-26627696 CTCTTCTCAGGAAGGAATGCTGG - Intergenic
1136048276 16:27632613-27632635 CCCTTACCAGGAAGAAATGCTGG + Intronic
1137337796 16:47567736-47567758 TTTTTATCATGAAGGGATGCTGG + Intronic
1137928573 16:52564999-52565021 TTATTTTCAGGAAGGAATGTGGG - Intergenic
1138717633 16:59042526-59042548 GTCTTATCAGGAAGAAAAGCTGG - Intergenic
1139043939 16:63033568-63033590 CCCTTATCAGGAAGGAATGCTGG - Intergenic
1139280882 16:65769446-65769468 CTCTTATCAGGAAGGAATACTGG - Intergenic
1139382234 16:66539948-66539970 CTGTTATCAGTTAGGAATGGTGG + Intronic
1139839344 16:69865864-69865886 CTCTTATCAGAAAGGAATGCCGG + Intronic
1140353357 16:74283543-74283565 CTCTTATCAGGAAGGAATGTGGG - Intergenic
1142435356 16:90053241-90053263 CTTTCAGCAGGGAGGAATGCTGG + Intergenic
1142907606 17:3055661-3055683 GTTTTATCATGAAGGGATGCTGG + Intergenic
1142926959 17:3248598-3248620 GTTTTATCATGAAGGGATGCTGG - Intergenic
1143721434 17:8813701-8813723 CTTTTATCATGAAGAGATGCTGG - Intronic
1143793257 17:9315353-9315375 CTCTTACCAGGAGGGAATGCTGG - Intronic
1143814410 17:9500387-9500409 CTCTTATGAGGTAGTAATCCGGG - Intronic
1146431020 17:32794914-32794936 CTGGTCTCAGGAAGGAATGACGG + Intronic
1146686951 17:34847553-34847575 CACTTATAGGGAAGGAATGCTGG - Intergenic
1148983223 17:51597701-51597723 CTCTTATTAGGAAGGAGTGCTGG + Intergenic
1149133569 17:53338191-53338213 CTCTTATAAGGCAGGTCTGCTGG - Intergenic
1149164821 17:53738518-53738540 CACTTATGAGAAATGAATGCAGG + Intergenic
1149294155 17:55246173-55246195 CACTTAGCAGCAAGGAAGGCTGG - Intergenic
1150101043 17:62423930-62423952 CTCTTATCGGCGAGGACTGCAGG - Exonic
1150920287 17:69475682-69475704 CTCCTAGGAAGAAGGAATGCAGG - Intronic
1152824705 17:82457511-82457533 CTCTTATCAGTAAGGAATACTGG + Intergenic
1153444368 18:5155183-5155205 CTCTTATCCCAAAGGAAGGCTGG - Intronic
1153957169 18:10107120-10107142 TTTTTATCAGGAAGGGATGTTGG + Intergenic
1153993444 18:10419919-10419941 GTCTTATCAGGAAGGAATGCTGG + Intergenic
1154098834 18:11448928-11448950 TTTTTATCATGAAGGAATGTTGG - Intergenic
1155589986 18:27416380-27416402 CTTTTATCATGAATGAGTGCTGG - Intergenic
1156120464 18:33836554-33836576 CTCTTATCAAGAAGAAAGGCTGG - Intergenic
1156212059 18:34955264-34955286 TTTTTATCATGAAGGAATGTTGG + Intergenic
1156661476 18:39351160-39351182 CTCTTACCAGGAAGGAATGTTGG - Intergenic
1157104208 18:44758047-44758069 CTCTTATCAGGAGGGAGAACAGG + Intronic
1159281677 18:66293757-66293779 CTCTTATAAGGCAGGCATGGTGG - Intergenic
1159515959 18:69458339-69458361 CTATTATCATGAAAGGATGCTGG - Intronic
1159593585 18:70361073-70361095 CTCTGATCAGGAAAGAATGCTGG + Intergenic
1162047887 19:8013351-8013373 ATTATATCAGGATGGAATGCTGG + Intronic
1164538745 19:29106489-29106511 CTGCTACCAGGAGGGAATGCGGG - Intergenic
1164732924 19:30519558-30519580 CTCTCTCCAGGAAGGAAAGCTGG - Intronic
1164776518 19:30857534-30857556 CTCTCATCAGGAAGGAGGGAAGG - Intergenic
1165401737 19:35605249-35605271 CTCTGATCAGGAAGGAATGCTGG - Intergenic
1165874287 19:38994830-38994852 ATCTTATCACGAAGGAATGCTGG - Intronic
1166905250 19:46103809-46103831 CTATTATCATTTAGGAATGCGGG + Intergenic
1167794031 19:51697524-51697546 CGCTTATCAGAAGGGAACGCTGG + Intergenic
1168130383 19:54314126-54314148 TTTTTATCATGAAGGGATGCAGG - Intergenic
925555783 2:5130359-5130381 CTCTTATCAGGAAGAAATGCTGG - Intergenic
925555962 2:5132003-5132025 CTCTCATCAGGAAGAAATGCTGG - Intergenic
925793758 2:7520917-7520939 ATCTTACCAGGAAGAAATGGGGG + Intergenic
926233243 2:11020605-11020627 CTCTTATCAAAAAGGAATGCTGG - Intergenic
926758449 2:16254431-16254453 CTCTTATCAGGAAGGGATGCTGG - Intergenic
927391746 2:22603964-22603986 GTTTTATCAGAAAGGAGTGCAGG - Intergenic
928253449 2:29701568-29701590 CTCTTATTATGAAGTAAAGCTGG + Intronic
928398343 2:30960255-30960277 CTCTAATCAGGGAGGGAAGCAGG + Intronic
929991564 2:46793872-46793894 CTCTTATCAGGAAGGAATGCTGG + Intergenic
930110734 2:47676439-47676461 CTCTTATCAGGAAGGAATTCTGG - Intergenic
930426174 2:51215937-51215959 CTCTTATTAGGAACGAATGCTGG + Intergenic
931249757 2:60519578-60519600 CTCTTGTAAGGAAAGAAGGCAGG - Intronic
931459390 2:62437141-62437163 CCCCTATCAGGAGGGAATACTGG + Intergenic
931537580 2:63296238-63296260 TTTTTATCATGAAGGGATGCTGG - Intronic
932056805 2:68453938-68453960 CTCTTATCAGGAAGGAATGATGG - Intergenic
932086380 2:68766226-68766248 TTCTCATCAGGTAGGACTGCAGG - Intronic
934025208 2:87996736-87996758 TTCTTATCAGGAAGGAACGTTGG + Intergenic
934890397 2:98063282-98063304 TTTTTATCATGAGGGAATGCTGG + Intergenic
936591558 2:113809294-113809316 GTCTTATCAGGAAGGAAGGCTGG - Intergenic
936626285 2:114152889-114152911 CTCTTATCAGGCAGAAAAGGAGG + Intergenic
939590847 2:144061965-144061987 CTCTCAGCAGGATGGAAAGCTGG - Intronic
939758158 2:146138850-146138872 ACCTTATCAGGAAGGAAAGAAGG + Intergenic
940090412 2:149909897-149909919 CTCTTCTCAGCTAGGAATGGTGG + Intergenic
940403967 2:153279557-153279579 CTTTTATCATGAAGAAATGTTGG + Intergenic
941690738 2:168498727-168498749 CTCTTACCAGGAAGGAGTGCTGG + Intronic
942093045 2:172512665-172512687 CTCTTATTAGGAAGAAATGCTGG - Intergenic
943050851 2:182911201-182911223 CCCTTAATAGGAAGGAATGCTGG - Intronic
943489850 2:188537381-188537403 ATTTTATCATGAAGGAATGCTGG + Intronic
943518363 2:188915730-188915752 CTTTTATCAAGAATAAATGCTGG + Intergenic
943635526 2:190302503-190302525 CTTTTATTAGGAAGGAATGCTGG + Intronic
944141285 2:196459716-196459738 CTCTTATCAAGAAGGAATGCTGG - Intronic
944607705 2:201367853-201367875 ATTTTATCAGGAAGGGATGTTGG - Intergenic
944949208 2:204727910-204727932 CTCTTACCAGGAAGGAATGCTGG + Intronic
945970831 2:216229579-216229601 TTTTTATCAGGAAGGGATGTTGG + Intergenic
946307062 2:218862037-218862059 CTTTGTTCAGGAAGGACTGCTGG + Intronic
947276124 2:228394609-228394631 CTTTTATTATGAAGGGATGCTGG + Intergenic
947445898 2:230162396-230162418 TTCTTATCAGGAATGACTGGAGG - Intergenic
1168941543 20:1716598-1716620 TTTTTATCATAAAGGAATGCTGG - Intergenic
1169410377 20:5364268-5364290 TTCTTATCAGGAAGGAATGCTGG + Intergenic
1169741576 20:8900677-8900699 GTATTATCAGAAAGCAATGCAGG + Intronic
1170322525 20:15116081-15116103 CTTTTACCAGGAAGGAAAGAAGG - Intronic
1170445125 20:16418562-16418584 TTCTTATCAGGAGGCAATGCTGG - Intronic
1170466427 20:16626538-16626560 CTCTTTTCTGGAAGGAATGCAGG - Intergenic
1170853876 20:20030356-20030378 TTTTTATCAGGAAGGAATATTGG - Intronic
1173444417 20:43105017-43105039 CTCTTACCAAGAAGAAAAGCAGG + Intronic
1173699301 20:45053809-45053831 CTCTTCTCAGAAATGACTGCAGG - Intronic
1174925078 20:54750470-54750492 CTCTTATCAGGAAGGAATGCTGG - Intergenic
1175009883 20:55724317-55724339 CTCTTATCAAGAAGAAATGCCGG - Intergenic
1175728490 20:61335534-61335556 CTCTTATTAGGAACAACTGCTGG - Intronic
1177246577 21:18532839-18532861 GTCTTATAAGGAAGGAAGGCTGG - Intergenic
1177677677 21:24323101-24323123 CCATGGTCAGGAAGGAATGCTGG - Intergenic
1179621809 21:42621305-42621327 CTCTCGTCGGGCAGGAATGCTGG + Intergenic
1180174531 21:46081300-46081322 CATTTATCAGGAAGGAATTTGGG - Intergenic
1181758573 22:25042051-25042073 TTCTTCACAGGCAGGAATGCTGG + Intronic
1182944164 22:34306381-34306403 CTCTTATAATGAAGGCAGGCTGG - Intergenic
1183701328 22:39452876-39452898 TTCTTATCAGGAAGGGATGATGG + Intergenic
1184439543 22:44500446-44500468 CTCTTACTAGGAAAGAATGCTGG - Intergenic
949803759 3:7932542-7932564 CTCTTATCAGGCTGGAGTGCAGG + Intergenic
950685669 3:14617037-14617059 CTCTTATCAGGAAAGGATGCTGG + Intergenic
950693695 3:14681456-14681478 CACTTACCAGGAAGGGCTGCTGG - Intronic
950814562 3:15686791-15686813 CTAAAATCAGGAAGGAATGGGGG - Intronic
951187836 3:19734886-19734908 CTATGATCAGGAAGAAAGGCTGG - Intergenic
951356282 3:21670891-21670913 CTCTTACCCACAAGGAATGCTGG - Intronic
951777371 3:26324557-26324579 CTCTTATCAGGAAGAAATGCTGG + Intergenic
952222301 3:31336414-31336436 TTCTTATCATAAAGGAATGTTGG - Intergenic
952704984 3:36368131-36368153 CTCTTATCGGGAAGGAATACTGG - Intergenic
954840478 3:53507371-53507393 CACTTAGCAGGGAGGATTGCTGG + Intronic
955405879 3:58625383-58625405 CTCTTATCAAGAAAGAATGCTGG - Intronic
955664126 3:61332341-61332363 CTCTCATCAGGAAGGAATGCTGG + Intergenic
955894212 3:63682068-63682090 CTCTTATCAAGATGGGATGACGG + Intergenic
956523585 3:70132232-70132254 CTTTTATCAGGAAGAAATGCTGG - Intergenic
956969459 3:74505381-74505403 TTCATATGAGGAAAGAATGCTGG + Intronic
957108406 3:75921207-75921229 CTCTTATAAGGCAGGACTGATGG + Intronic
957288232 3:78244342-78244364 CTCTTATCAGGAAGAAATACTGG - Intergenic
957571008 3:81947502-81947524 CTCTTTTCAGGAAGAAATGCTGG + Intergenic
958625107 3:96613516-96613538 CTGTTGACAGGAAGGAATGCTGG - Intergenic
959124931 3:102279253-102279275 CTTTTATCATGAAGGGATGTTGG + Intronic
959157656 3:102686039-102686061 CTCTTATCAGAAAGGAATGCTGG - Intergenic
959285975 3:104411859-104411881 CTCTAATGAGGAAGGAAGCCTGG + Intergenic
959428827 3:106226269-106226291 CTTTTATCAAGAATGAATGTTGG + Intergenic
959781555 3:110240279-110240301 CACGTATCAGGAAGGAATGCTGG + Intergenic
959823185 3:110761358-110761380 CTCTGCTTATGAAGGAATGCTGG + Intergenic
960020862 3:112951157-112951179 CTAATATCAGGAAGGAAGGAAGG + Intronic
960613265 3:119574004-119574026 CTCTTATCAGGGCAGAATGATGG + Intergenic
961378242 3:126481264-126481286 CTCCTAACAGCAAGGAAGGCTGG + Intronic
962049258 3:131795583-131795605 CTCTTATCAGGAAGAAATGCTGG - Intronic
962806297 3:138929885-138929907 CTCTTGCCAGGAATGACTGCTGG - Intergenic
963056218 3:141188396-141188418 CTGTCCTCAGGGAGGAATGCTGG + Intergenic
963762372 3:149296639-149296661 CTCTTATCAGGAAGGAAGGCTGG - Intergenic
964635663 3:158855851-158855873 TTTTTATCATAAAGGAATGCTGG + Intergenic
964932502 3:162044483-162044505 CTCAGATCAGGAAGGAAGGAAGG - Intergenic
965268682 3:166583769-166583791 ATTTTATCATGAAGGAATGTTGG + Intergenic
966235317 3:177694988-177695010 CTGTGATCAGGGAGGAATGCAGG - Intergenic
968963050 4:3755074-3755096 CTCCTATCAGGAAGGAACGCTGG - Intergenic
968981550 4:3852632-3852654 CTCCTATCAGGAAGGAACTCAGG - Intergenic
969144468 4:5109574-5109596 CTCTTATCATGGAGGACTGCTGG - Intronic
969199407 4:5590594-5590616 GTATTATCCGGAAGGAATGCTGG - Intronic
969338472 4:6526002-6526024 CTCTTATCAAGAAGGAATGCTGG - Intronic
969901987 4:10358659-10358681 CTCATATCAGGAAGAAAAGTTGG - Intergenic
970496439 4:16630402-16630424 CTCTTATAAGGTAGGCCTGCTGG - Intronic
970820388 4:20205229-20205251 CTCCTATCAGGAAGGAAATTTGG + Intergenic
973572339 4:52253213-52253235 CTCTTACCAGGAAGAAATGCTGG + Intergenic
973581024 4:52344328-52344350 CTCCTATCAGGAAGGAATGCTGG - Intergenic
973733120 4:53842861-53842883 CTCTTATTAGGAAGGAATGCTGG + Intronic
973925217 4:55730006-55730028 CTCTTATCAGGAAGGAATGCTGG - Intergenic
975207523 4:71662312-71662334 CTCTTATGAGGAAGAAACGCTGG + Intergenic
976286683 4:83377204-83377226 CTCTTATCATGAAGGAATGCTGG - Intergenic
976554198 4:86431973-86431995 CTTTTATTAGGAAGGAATGCTGG + Intronic
977721121 4:100241516-100241538 CTCTTACCAGGGAGGAATGCTGG + Intergenic
978114084 4:104998434-104998456 TTTTTATCATGAAGGAATGTTGG + Intergenic
978153170 4:105461396-105461418 CTCTTATCAGGAGGGAACGCTGG + Intronic
978925823 4:114242319-114242341 TTTTTATCAGGAAGGGATGCTGG + Intergenic
979398541 4:120219256-120219278 TTTTTATCATGAAGGAATGTTGG + Intergenic
979398550 4:120219386-120219408 TTTTTATCATGAAGGAATGGTGG + Intergenic
979590992 4:122480175-122480197 CTCTTATCAGGAAGGAATGCTGG + Intergenic
980003997 4:127520177-127520199 CTCTTTTCAGAAAGGATTTCAGG + Intergenic
980117475 4:128692998-128693020 CTCTTACCAGGAAGGAATACTGG - Intergenic
980662231 4:135877031-135877053 CTCTCAACTGGAAGGAAGGCTGG + Intergenic
980827665 4:138091806-138091828 CTCTTATCAGGAAGGAATGCTGG + Intergenic
981130723 4:141155775-141155797 CTCTCACCAGCCAGGAATGCTGG + Intronic
982576921 4:157124011-157124033 CAACTATCAGGAAGGAATTCTGG + Intronic
983097075 4:163575235-163575257 TTTTTATCATGAAGGAATGCTGG + Intronic
983470685 4:168150822-168150844 CTCTAGCCAGGAAAGAATGCTGG + Intronic
983770447 4:171542084-171542106 CTCTTATCAGAAAGGAACGCTGG - Intergenic
984192246 4:176619857-176619879 CTCTTACCAGGAAGGCATGCTGG + Intergenic
984371429 4:178871417-178871439 CTCTCATCAGGAAGGAAAGCTGG - Intergenic
984522461 4:180817958-180817980 CTCTTATCAGGATGGAATGCTGG + Intergenic
984904951 4:184618008-184618030 CTCTTATCAGGAGGGAATGCTGG + Intergenic
985627478 5:997045-997067 CTGTTATCAGGAAGGAATGCTGG - Intergenic
986060384 5:4184018-4184040 GTTTTATCATGAAGGAATGTTGG + Intergenic
986730510 5:10631877-10631899 CTCTCATGAGGACGGAATGCTGG + Intronic
986807856 5:11325840-11325862 CTCCTATGTTGAAGGAATGCTGG - Intronic
986861965 5:11936952-11936974 CTCTTATTGGGAAGGAATACTGG - Intergenic
986975229 5:13386452-13386474 TTTTTATCATGAAGGGATGCTGG - Intergenic
987203382 5:15600228-15600250 CTCTTATCAGGAAGGAATGCTGG + Intronic
987270662 5:16305038-16305060 CTCTCATCAGGAAGGAATGCTGG + Intergenic
987692406 5:21283631-21283653 CTCTTAACAGAAAAAAATGCCGG - Intergenic
988186172 5:27865850-27865872 TTTTTATCATAAAGGAATGCTGG - Intergenic
988195491 5:28000056-28000078 TTTTTATCAGTAAGGGATGCTGG + Intergenic
988231357 5:28483825-28483847 CTCTCAGCAGGAAGGAGAGCTGG + Intergenic
988309109 5:29534535-29534557 CTTTAATCATGAAGGAATGTTGG + Intergenic
988315659 5:29623461-29623483 CTGTTCTGAGGAAGGAATTCAGG + Intergenic
989078658 5:37591968-37591990 ATTTTATCATGAATGAATGCTGG - Intronic
989324048 5:40169626-40169648 CTTTTATCATGAAAGAATGTTGG - Intergenic
989432605 5:41373220-41373242 CTCTGTTGAGGAAGAAATGCTGG - Intronic
989505877 5:42227290-42227312 CTCTTATAAGGCAGGTATGGTGG + Intergenic
989736586 5:44715064-44715086 TTTTTATCAGGAAGGAATGCTGG - Intergenic
990694198 5:58396815-58396837 CTCTTATCAGGCAGAAAAGGAGG + Intergenic
991144287 5:63282960-63282982 CTCCTACTAGGAAGGAATGCTGG + Intergenic
991164826 5:63553178-63553200 CTATTATCAGTAAGGAAAGAAGG + Intergenic
992468357 5:77029659-77029681 CTCTTATCAGGAAGGAATGCTGG - Intronic
992999365 5:82365129-82365151 CTTTAATCAGGAAGGAAGGAAGG - Intronic
993167972 5:84382615-84382637 CTCTTAGCAGGAAGGGAAGGGGG - Intronic
993366557 5:87041208-87041230 CTCTTATAAGGCAGGACTGGTGG + Intergenic
995482578 5:112607937-112607959 CTTTTATCAGGACGAAATGCTGG + Intergenic
996345270 5:122480732-122480754 TTCTTATCATGTAGGAATGCTGG + Intergenic
996554195 5:124761080-124761102 GTCTTAAAGGGAAGGAATGCTGG + Intergenic
996820504 5:127621308-127621330 CCCTTATCAGAAAGGAATGCTGG + Intergenic
998421048 5:141987025-141987047 CTATTGGCAGGAAGAAATGCTGG + Intronic
998720292 5:144938608-144938630 CTTTTATCATGAAGGAAGGTTGG - Intergenic
999083248 5:148864092-148864114 TTGTTGTCAGGTAGGAATGCAGG - Intergenic
999118123 5:149182912-149182934 CTTTTATAAGGAAGGCATGAAGG - Intronic
999224896 5:150013278-150013300 CTTTTATCAGGAATGCATGTTGG + Intronic
999302345 5:150498992-150499014 CTCTTCTGGGGAAGGAATCCTGG - Intronic
999390316 5:151184917-151184939 CTTTTCTCAGGAAGGAAAGAGGG - Intronic
999413700 5:151376191-151376213 TTTTTATCATGAGGGAATGCTGG + Intergenic
1000215456 5:159151379-159151401 CTTTTATCATAAAGGGATGCTGG + Intergenic
1000401296 5:160830138-160830160 CTTTTATCATGAAGGGATGTTGG + Intronic
1000970703 5:167711201-167711223 CTATAAGCAGGAAGGAATACAGG + Intronic
1001911511 5:175522549-175522571 CTCTTAAAAGGAAGGGATGGAGG + Intronic
1002254166 5:177946532-177946554 TTCTTATAAGGTAGGAGTGCTGG + Intergenic
1003018521 6:2488777-2488799 CTCTCATCTGGAAGGAATGCTGG - Intergenic
1003096603 6:3147306-3147328 CACTTTTGAGGATGGAATGCTGG + Intronic
1003192928 6:3889974-3889996 CTCTTATCAGGAAGGAATACTGG - Intergenic
1003471610 6:6440949-6440971 TTTTTATGATGAAGGAATGCTGG - Intergenic
1003798033 6:9628366-9628388 CTCCTATCAAGAAGGAATGCTGG + Intronic
1005077495 6:21922872-21922894 CTCTTTTCAAGAAGAAATTCAGG + Intergenic
1006238734 6:32658896-32658918 CTCTTATTAGGAAGGAGGACTGG - Intergenic
1006247757 6:32755122-32755144 CTCTTATTAGGAAGGAGGACTGG - Intergenic
1007279658 6:40701719-40701741 TTTTTATCAGGAAGGGAGGCAGG + Intergenic
1007623344 6:43228329-43228351 CTCCTATTAGCAAGGACTGCAGG - Intronic
1008104131 6:47424667-47424689 CTCTTATCAGGAAGGAACGCTGG - Intergenic
1008656203 6:53616741-53616763 CTTTTATCAGGAGAGGATGCTGG - Intronic
1008871213 6:56274160-56274182 CTTTTATCATGAAGGGATGTTGG - Intronic
1008982614 6:57502359-57502381 CTCTTGTCAGGAGGGAATGTTGG - Intronic
1009170687 6:60395222-60395244 CTCTTGTCAGGAGGGAATGTTGG - Intergenic
1009700371 6:67170032-67170054 TTTTTATCATGAAGGAAGGCTGG - Intergenic
1009709859 6:67303385-67303407 CTCTTATCAGGAATGAAAGAAGG - Intergenic
1009880707 6:69562429-69562451 CTCTTGTAAGGCAGGGATGCTGG - Intergenic
1010027986 6:71241736-71241758 GTTTTATCATAAAGGAATGCTGG - Intergenic
1010151969 6:72743657-72743679 AACTTATAAGGAAAGAATGCTGG + Intronic
1010270941 6:73915401-73915423 ATCTTATAAGGAAGGAATGGAGG - Intergenic
1011253202 6:85394627-85394649 CTCTTATCAGGAAAACATGCTGG + Intergenic
1011752610 6:90468422-90468444 CTCCTATGAGAAATGAATGCTGG - Intergenic
1011809392 6:91112988-91113010 CTCTTATCCGAAAGGAATGCTGG - Intergenic
1011832075 6:91386173-91386195 CACTCATCAGGAAGTAATTCAGG - Intergenic
1011899531 6:92275085-92275107 CTCTCAGCAGGAAGGGAAGCTGG + Intergenic
1012080214 6:94748851-94748873 CTCTTATTAGGGACTAATGCAGG - Intergenic
1012710953 6:102603842-102603864 CTCTTATAAGGCAGGAATGCTGG - Intergenic
1012770528 6:103427665-103427687 GTTTTATCATGAAGGTATGCTGG - Intergenic
1013083052 6:106829632-106829654 ATCTTATCAGGAGAGAATGCTGG - Intergenic
1013824425 6:114194567-114194589 CCTTTATCAAGAAGAAATGCTGG - Intronic
1014234317 6:118937799-118937821 CTTTTATCAAGAATGAATGTTGG + Intergenic
1014525717 6:122499504-122499526 TTCTTTTCATGAAGGGATGCTGG - Intronic
1015951805 6:138560767-138560789 CCGTATTCAGGAAGGAATGCTGG + Intronic
1016221186 6:141671748-141671770 TTTTTATCATGAAGGGATGCTGG - Intergenic
1017357984 6:153532536-153532558 TTTTTATCATGAAGGGATGCTGG + Intergenic
1017447938 6:154526244-154526266 CCCTTAACAGGAAGGAATTTTGG - Intergenic
1018056196 6:160054439-160054461 CTCTTATCAGCAGGGAATGCTGG + Intronic
1018714255 6:166519765-166519787 CTCTTTTCAGGCAGCAATGCAGG + Intronic
1018922013 6:168181866-168181888 CTCTTGTCGGGAAGGGACGCTGG - Intergenic
1019155437 6:170035750-170035772 CTCCCATCAGGAAGGAGTGCTGG - Intergenic
1019225792 6:170506936-170506958 CTCTTATCAGGAAGGAATGCCGG + Intergenic
1020695957 7:11414179-11414201 TTCTTATTAGGAAGAAATGCTGG - Intronic
1023353310 7:39341718-39341740 CACCTAACAGGAAGGAATACTGG - Intronic
1023417471 7:39946873-39946895 GTCTTATCTGCAAGGAATACTGG + Intergenic
1023877683 7:44296883-44296905 TTCTTATAAGGCAGGTATGCTGG - Intronic
1024100645 7:46029288-46029310 CTGTTAGCATGAAGGTATGCTGG + Intergenic
1025831341 7:65053375-65053397 CTCTTATCACTAAGGATTTCTGG - Intergenic
1025918484 7:65887275-65887297 CTCTTATCACTAAGGATTTCTGG - Intronic
1026011231 7:66638232-66638254 CTCTAAGCAGGAAGGAAAGAGGG - Exonic
1026350780 7:69513372-69513394 CTGCTATCAGGAAAGAATACTGG + Intergenic
1026561569 7:71454862-71454884 CTCTTATCAAGAAGGAATCCTGG + Intronic
1028048127 7:86149585-86149607 CTCTGATCAGGAAAGAATTTAGG - Intergenic
1028071960 7:86461309-86461331 CTCTTATTGGGAAGGAATGCTGG - Intergenic
1028649077 7:93130263-93130285 CTCTAATCAGGCAGGAATGATGG + Exonic
1029093528 7:98067263-98067285 CTCTTATCAGGGAAGAATGCTGG + Intergenic
1030440764 7:109586212-109586234 TTTTTATCATGAAGAAATGCTGG - Intergenic
1030721177 7:112872412-112872434 TTTTTATCATGAAGGAATGCTGG - Intronic
1031139198 7:117922806-117922828 TTTTAATCATGAAGGAATGCTGG - Intergenic
1031536466 7:122939617-122939639 CTTTTATCATGAAGGGATGTTGG + Intergenic
1031705221 7:124972629-124972651 CTCTGAGCAAGAAGGAATCCTGG - Intergenic
1032030195 7:128476793-128476815 CTCTTATCGGCGAGGATTGCAGG - Exonic
1032134413 7:129262532-129262554 CTCCTATTAGGAAGGAATGCTGG + Intronic
1032246553 7:130218394-130218416 CTCTTATCAGGAATGACTCATGG - Intergenic
1032303733 7:130713395-130713417 CTCTTACCAGGAAGGTTTGGAGG - Intergenic
1034034612 7:147805622-147805644 TTTTTATCATGAAGGAATGCTGG + Intronic
1034364164 7:150532057-150532079 CTCTTGTAAGGCAGGAATGGTGG + Intergenic
1034542883 7:151770189-151770211 CTCTTATCAGGAAGGAATGCTGG - Intronic
1035232897 7:157476992-157477014 CTCTTACCAGGCAGGAAAGGAGG - Intergenic
1036954758 8:13175851-13175873 CTGTGACCAGGAAGGAAAGCAGG - Intronic
1037123576 8:15318398-15318420 CTCTTATCAGGAAGGAATGCTGG + Intergenic
1037134946 8:15449456-15449478 CTCTTACCAGGAAGGAATGCTGG + Intronic
1038347237 8:26743580-26743602 CTCTCATCAGGAGGGAATGTGGG - Intergenic
1039305566 8:36258661-36258683 CTCTTATCAGGAAGAAATGCTGG + Intergenic
1039810195 8:41040533-41040555 CTTTAATCATAAAGGAATGCTGG + Intergenic
1040633511 8:49244288-49244310 TTTTTATCAAGAAAGAATGCTGG - Intergenic
1040812117 8:51465344-51465366 TTTTTATCATGAAGGAATGTTGG - Intronic
1041409902 8:57542072-57542094 CTCTTCTGTGGAAGAAATGCTGG - Intergenic
1041418885 8:57645163-57645185 CTCTTATAAGGTAGGCATGGTGG + Intergenic
1041832699 8:62173891-62173913 ATTTTATCATGAAGGGATGCTGG + Intergenic
1042205837 8:66328895-66328917 CTCTCATCAGGAAGGAATGCTGG - Intergenic
1042940175 8:74099437-74099459 CTCTCATCAGGAAGAAATGCTGG - Intergenic
1043091609 8:75911865-75911887 CTTTTATCAAGAAGGAATGCTGG + Intergenic
1043556368 8:81435162-81435184 GTTTTATCATAAAGGAATGCTGG + Intergenic
1045099753 8:98832482-98832504 CACTTACCAGAAAGGAATGCTGG + Intronic
1045273591 8:100682200-100682222 CTCTCACCAGGCTGGAATGCAGG + Intergenic
1045345902 8:101293235-101293257 TTTTCATCAGGAAGGAAAGCAGG + Intergenic
1045723337 8:105140106-105140128 CTCTAACCCAGAAGGAATGCAGG - Intronic
1046914910 8:119669733-119669755 CTCTTCTCAGAAAAAAATGCAGG - Intronic
1047378910 8:124336916-124336938 CTCATATCAGGAATGAAAGAAGG + Intronic
1048187286 8:132252951-132252973 CTCTTAACAGCTAGGAATGAAGG - Intronic
1048356454 8:133657731-133657753 CTCTCATCACGAAGAAATGGAGG + Intergenic
1048372134 8:133788141-133788163 CTCTGATCAGGTAAGAATGATGG + Intergenic
1049711815 8:144067969-144067991 TCTCTATCAGGAAGGAATGCAGG - Intergenic
1050025937 9:1334687-1334709 ATATTATGAGGAAGGAAGGCAGG - Intergenic
1050830685 9:10008341-10008363 CTCTCATCAGGAAGGAATGCTGG - Intronic
1051258507 9:15238057-15238079 TTTTTATCAGGAAGGCATGTTGG - Intronic
1052751668 9:32498121-32498143 CTCTTATCAGGAAGAAGTGCTGG - Intronic
1053605778 9:39657049-39657071 CTTTTATCATGAAGGGATGTTGG + Intergenic
1053612076 9:39724292-39724314 CTCTTATTGGGAAGGAATGCTGG - Intergenic
1053802599 9:41773854-41773876 CCCTTACCAGGTAGGGATGCAGG + Intergenic
1053863694 9:42413674-42413696 CTTTTATCATGAAGGGATGTTGG + Intergenic
1053870110 9:42482284-42482306 CTCTTATTGGGAAGGAATGCTGG - Intergenic
1053898864 9:42773030-42773052 CTCTGATCAGGCAGGATTGTAGG + Intergenic
1054086181 9:60746864-60746886 CTCTTATTGGGAAGGAATGCTGG + Intergenic
1054142639 9:61541216-61541238 CCCTTACCAGGTAGGGATGCAGG - Intergenic
1054241442 9:62618101-62618123 CTCTTATTGGGAAGGAATGCTGG + Intergenic
1054247766 9:62685366-62685388 CTTTTATCATGAAGGGATGTTGG - Intergenic
1054555570 9:66652624-66652646 CTCTTATTGGGAAGGAATGCTGG + Intergenic
1054561882 9:66719891-66719913 CTTTTATCATGAAGGGATGTTGG - Intergenic
1054647464 9:67602517-67602539 CCCTTACCAGGTAGGGATGCAGG - Intergenic
1054771218 9:69086103-69086125 CTGTTATCAGGAAGGAATGCTGG + Intronic
1055329697 9:75171085-75171107 CTCTTATCAGGAAGGAATGCTGG - Intergenic
1056959553 9:91110838-91110860 CTCTTGTTAGGAACTAATGCAGG - Intergenic
1056981349 9:91314836-91314858 TCTTTATCAGGAAGAAATGCTGG - Intronic
1056982895 9:91332952-91332974 CTCTTATCAGGAAAGAACGCTGG + Intronic
1057419696 9:94901010-94901032 CTTTTAACAGGAAGGAATATTGG - Intronic
1057513823 9:95704135-95704157 CTGATATGTGGAAGGAATGCAGG + Intergenic
1058189156 9:101891864-101891886 CTCTTATGAAGAAGGAATGCCGG - Intergenic
1058275533 9:103037380-103037402 CTGTTTTCAAGAAGCAATGCAGG + Intergenic
1058826073 9:108777077-108777099 CTCTTATCAGGAAGGAATGCTGG - Intergenic
1058896551 9:109405546-109405568 CTCCCATCAGGCAGCAATGCAGG + Intronic
1059077954 9:111214862-111214884 TTTTTATCAGGAAGGGATGCTGG + Intergenic
1059479471 9:114577261-114577283 CTCTTAACAGGAAGGAGTGCTGG + Intergenic
1059510559 9:114841224-114841246 CTCTTATCAGGCAGGCCTGATGG - Intergenic
1059891049 9:118804789-118804811 TTTTTATCATGAAGGAATGTTGG - Intergenic
1059963412 9:119589704-119589726 CTCTTAGCAGAAAGGAAAGCTGG - Intergenic
1062011265 9:134268120-134268142 CTCTTATCAGGAGCCAGTGCTGG + Intergenic
1062251293 9:135596441-135596463 CTCTTATCAGGAAGGAATGCTGG - Intergenic
1062608737 9:137362448-137362470 TTTTTATCAGGAATGTATGCTGG - Intronic
1186178096 X:6946087-6946109 CTCTTATCAGGAAGAAATACTGG - Intergenic
1186689436 X:11959572-11959594 CCCTTATCAGGAAGGAATGCTGG + Intergenic
1186709063 X:12173782-12173804 AGCTTATCAGGAAGGAGAGCAGG - Intronic
1187791563 X:22955928-22955950 CTCTTACCAGGAAGGAATGCTGG - Intergenic
1187856398 X:23640066-23640088 TTTTTATCATGAAAGAATGCTGG - Intergenic
1189150487 X:38701278-38701300 CTCTTATCAGGAAGGAATGCTGG - Intergenic
1189551310 X:42096426-42096448 CTCTTATCAGGAAGGAATGCTGG - Intergenic
1189830193 X:44964815-44964837 CTCTTGTTAGGAACTAATGCTGG - Intronic
1190530731 X:51372977-51372999 TTTTTATCATGAAGGGATGCTGG - Intergenic
1190558036 X:51657531-51657553 GTTTTACCAGGAATGAATGCTGG + Intergenic
1190993431 X:55578479-55578501 CTATTATTAGAAAGCAATGCTGG + Intergenic
1190997753 X:55627673-55627695 CTCTTATAAGGCAGGCCTGCTGG - Intergenic
1192064515 X:67866892-67866914 CTTTTATCATGAAGGGATGCTGG + Intergenic
1192986074 X:76399424-76399446 CTCTGATCAGGCAGGTTTGCAGG - Intergenic
1193776243 X:85645954-85645976 TTTTTATCATGAAGGAATGTTGG - Intergenic
1193788285 X:85787502-85787524 TTTTTATCATGAAGGAATGTTGG - Intergenic
1194188876 X:90809451-90809473 CTCTTAGAAGAAAAGAATGCTGG - Intergenic
1194226210 X:91261737-91261759 TTTTTATCATGAAGGAATGTTGG + Intergenic
1194318637 X:92414009-92414031 CTATTATTAGGAAGAAGTGCTGG + Intronic
1194373626 X:93105939-93105961 TTTTTATCATGAAGGAATGTTGG + Intergenic
1194538917 X:95146086-95146108 CTCTGATCAGGCAGGGTTGCAGG + Intergenic
1194690645 X:96980264-96980286 CTCTTAGCCGGAAGGAAAGCTGG + Intronic
1194761118 X:97797278-97797300 CTTTTATCAGGGAGGAATGCTGG - Intergenic
1195168439 X:102243237-102243259 ATTTTATCAGGAAGGAATGTTGG + Intergenic
1195190418 X:102443850-102443872 ATTTTATCAGGAAGGAATGTTGG - Intronic
1196219871 X:113100646-113100668 TTTTTATCACGAAGGAATGTTGG + Intergenic
1196385456 X:115143924-115143946 TTTTTATCATGAAGGAATGTTGG - Intronic
1196534386 X:116824920-116824942 CTCTTATCAGGAAGGAATGCTGG + Intergenic
1196566632 X:117213719-117213741 TTCTTATCATGAAGGGATGTTGG - Intergenic
1197156301 X:123273567-123273589 CTCTCATCAGGAAGGAGGACTGG + Intronic
1197668754 X:129252426-129252448 CTTTAATCAGCAAGGGATGCTGG + Intergenic
1199106987 X:143880634-143880656 TTTTTATCATGAAGGAATGTTGG - Intergenic
1199284440 X:146040277-146040299 CTTTTAACATGAAGGGATGCTGG - Intergenic
1200535458 Y:4391348-4391370 CTCTTAGAAGAAAAGAATGCTGG - Intergenic
1200626777 Y:5527166-5527188 CTATTATTAGGAAGAAGTGCTGG + Intronic
1200681651 Y:6219974-6219996 TTTTTATCATGAAGGAATGTTGG + Intergenic