ID: 1133872936

View in Genome Browser
Species Human (GRCh38)
Location 16:9706427-9706449
Sequence ATGGTCTGTGGTCTCTTATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133872936_1133872943 15 Left 1133872936 16:9706427-9706449 CCTGATAAGAGACCACAGACCAT No data
Right 1133872943 16:9706465-9706487 GGTTTACAGAGGCTGCACATAGG No data
1133872936_1133872939 -10 Left 1133872936 16:9706427-9706449 CCTGATAAGAGACCACAGACCAT No data
Right 1133872939 16:9706440-9706462 CACAGACCATGGACTCATTCTGG No data
1133872936_1133872942 4 Left 1133872936 16:9706427-9706449 CCTGATAAGAGACCACAGACCAT No data
Right 1133872942 16:9706454-9706476 TCATTCTGGCTGGTTTACAGAGG No data
1133872936_1133872940 -6 Left 1133872936 16:9706427-9706449 CCTGATAAGAGACCACAGACCAT No data
Right 1133872940 16:9706444-9706466 GACCATGGACTCATTCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133872936 Original CRISPR ATGGTCTGTGGTCTCTTATC AGG (reversed) Intergenic
No off target data available for this crispr