ID: 1133872938

View in Genome Browser
Species Human (GRCh38)
Location 16:9706439-9706461
Sequence CAGAATGAGTCCATGGTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133872938_1133872942 -8 Left 1133872938 16:9706439-9706461 CCACAGACCATGGACTCATTCTG No data
Right 1133872942 16:9706454-9706476 TCATTCTGGCTGGTTTACAGAGG No data
1133872938_1133872943 3 Left 1133872938 16:9706439-9706461 CCACAGACCATGGACTCATTCTG No data
Right 1133872943 16:9706465-9706487 GGTTTACAGAGGCTGCACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133872938 Original CRISPR CAGAATGAGTCCATGGTCTG TGG (reversed) Intergenic
No off target data available for this crispr