ID: 1133872939

View in Genome Browser
Species Human (GRCh38)
Location 16:9706440-9706462
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133872935_1133872939 -6 Left 1133872935 16:9706423-9706445 CCTTCCTGATAAGAGACCACAGA No data
Right 1133872939 16:9706440-9706462 CACAGACCATGGACTCATTCTGG No data
1133872933_1133872939 6 Left 1133872933 16:9706411-9706433 CCGACCAGCATTCCTTCCTGATA No data
Right 1133872939 16:9706440-9706462 CACAGACCATGGACTCATTCTGG No data
1133872934_1133872939 2 Left 1133872934 16:9706415-9706437 CCAGCATTCCTTCCTGATAAGAG No data
Right 1133872939 16:9706440-9706462 CACAGACCATGGACTCATTCTGG No data
1133872936_1133872939 -10 Left 1133872936 16:9706427-9706449 CCTGATAAGAGACCACAGACCAT No data
Right 1133872939 16:9706440-9706462 CACAGACCATGGACTCATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133872939 Original CRISPR CACAGACCATGGACTCATTC TGG Intergenic