ID: 1133872942

View in Genome Browser
Species Human (GRCh38)
Location 16:9706454-9706476
Sequence TCATTCTGGCTGGTTTACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133872933_1133872942 20 Left 1133872933 16:9706411-9706433 CCGACCAGCATTCCTTCCTGATA No data
Right 1133872942 16:9706454-9706476 TCATTCTGGCTGGTTTACAGAGG No data
1133872938_1133872942 -8 Left 1133872938 16:9706439-9706461 CCACAGACCATGGACTCATTCTG No data
Right 1133872942 16:9706454-9706476 TCATTCTGGCTGGTTTACAGAGG No data
1133872934_1133872942 16 Left 1133872934 16:9706415-9706437 CCAGCATTCCTTCCTGATAAGAG No data
Right 1133872942 16:9706454-9706476 TCATTCTGGCTGGTTTACAGAGG No data
1133872936_1133872942 4 Left 1133872936 16:9706427-9706449 CCTGATAAGAGACCACAGACCAT No data
Right 1133872942 16:9706454-9706476 TCATTCTGGCTGGTTTACAGAGG No data
1133872935_1133872942 8 Left 1133872935 16:9706423-9706445 CCTTCCTGATAAGAGACCACAGA No data
Right 1133872942 16:9706454-9706476 TCATTCTGGCTGGTTTACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133872942 Original CRISPR TCATTCTGGCTGGTTTACAG AGG Intergenic