ID: 1133872943

View in Genome Browser
Species Human (GRCh38)
Location 16:9706465-9706487
Sequence GGTTTACAGAGGCTGCACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133872934_1133872943 27 Left 1133872934 16:9706415-9706437 CCAGCATTCCTTCCTGATAAGAG 0: 24
1: 53
2: 69
3: 63
4: 325
Right 1133872943 16:9706465-9706487 GGTTTACAGAGGCTGCACATAGG No data
1133872938_1133872943 3 Left 1133872938 16:9706439-9706461 CCACAGACCATGGACTCATTCTG No data
Right 1133872943 16:9706465-9706487 GGTTTACAGAGGCTGCACATAGG No data
1133872941_1133872943 -4 Left 1133872941 16:9706446-9706468 CCATGGACTCATTCTGGCTGGTT No data
Right 1133872943 16:9706465-9706487 GGTTTACAGAGGCTGCACATAGG No data
1133872935_1133872943 19 Left 1133872935 16:9706423-9706445 CCTTCCTGATAAGAGACCACAGA No data
Right 1133872943 16:9706465-9706487 GGTTTACAGAGGCTGCACATAGG No data
1133872936_1133872943 15 Left 1133872936 16:9706427-9706449 CCTGATAAGAGACCACAGACCAT No data
Right 1133872943 16:9706465-9706487 GGTTTACAGAGGCTGCACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133872943 Original CRISPR GGTTTACAGAGGCTGCACAT AGG Intergenic
No off target data available for this crispr