ID: 1133875925

View in Genome Browser
Species Human (GRCh38)
Location 16:9734245-9734267
Sequence GAATCTTATTTTTAAATGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133875925_1133875927 0 Left 1133875925 16:9734245-9734267 CCGGGCATTTAAAAATAAGATTC No data
Right 1133875927 16:9734268-9734290 CTCCCTCTTGCTGTTTCGCCAGG No data
1133875925_1133875930 14 Left 1133875925 16:9734245-9734267 CCGGGCATTTAAAAATAAGATTC No data
Right 1133875930 16:9734282-9734304 TTCGCCAGGAATTGTCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133875925 Original CRISPR GAATCTTATTTTTAAATGCC CGG (reversed) Intergenic
No off target data available for this crispr