ID: 1133876661

View in Genome Browser
Species Human (GRCh38)
Location 16:9741088-9741110
Sequence GCATCCACCCCAGGAACACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133876653_1133876661 9 Left 1133876653 16:9741056-9741078 CCCAAAAGAAGGGCACCTCAACT No data
Right 1133876661 16:9741088-9741110 GCATCCACCCCAGGAACACTTGG No data
1133876649_1133876661 26 Left 1133876649 16:9741039-9741061 CCCAACTTCGTGGCTGTCCCAAA No data
Right 1133876661 16:9741088-9741110 GCATCCACCCCAGGAACACTTGG No data
1133876658_1133876661 -6 Left 1133876658 16:9741071-9741093 CCTCAACTCTGGCCAGGGCATCC No data
Right 1133876661 16:9741088-9741110 GCATCCACCCCAGGAACACTTGG No data
1133876654_1133876661 8 Left 1133876654 16:9741057-9741079 CCAAAAGAAGGGCACCTCAACTC No data
Right 1133876661 16:9741088-9741110 GCATCCACCCCAGGAACACTTGG No data
1133876650_1133876661 25 Left 1133876650 16:9741040-9741062 CCAACTTCGTGGCTGTCCCAAAA No data
Right 1133876661 16:9741088-9741110 GCATCCACCCCAGGAACACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133876661 Original CRISPR GCATCCACCCCAGGAACACT TGG Intergenic
No off target data available for this crispr