ID: 1133881450

View in Genome Browser
Species Human (GRCh38)
Location 16:9786385-9786407
Sequence TCCCACGGTGCTGGGGCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 419}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133881440_1133881450 24 Left 1133881440 16:9786338-9786360 CCCAAACTGGCAGGGTTGAATGA 0: 1
1: 0
2: 0
3: 10
4: 124
Right 1133881450 16:9786385-9786407 TCCCACGGTGCTGGGGCCTGAGG 0: 1
1: 0
2: 2
3: 36
4: 419
1133881439_1133881450 25 Left 1133881439 16:9786337-9786359 CCCCAAACTGGCAGGGTTGAATG 0: 1
1: 0
2: 0
3: 11
4: 144
Right 1133881450 16:9786385-9786407 TCCCACGGTGCTGGGGCCTGAGG 0: 1
1: 0
2: 2
3: 36
4: 419
1133881441_1133881450 23 Left 1133881441 16:9786339-9786361 CCAAACTGGCAGGGTTGAATGAT 0: 1
1: 0
2: 0
3: 4
4: 105
Right 1133881450 16:9786385-9786407 TCCCACGGTGCTGGGGCCTGAGG 0: 1
1: 0
2: 2
3: 36
4: 419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133881450 Original CRISPR TCCCACGGTGCTGGGGCCTG AGG Intronic
900090889 1:919963-919985 CCTCAAGGTGCTGGGGCCTCTGG + Intergenic
900118110 1:1037100-1037122 TCCCAGTGGGCTGGGTCCTGGGG + Intronic
900124794 1:1064602-1064624 GCCCACGGCCCTGGTGCCTGTGG - Intergenic
900457751 1:2785700-2785722 TCCCCAGGTGCAGGGGCCTCAGG - Intronic
900556925 1:3285237-3285259 CTCCACGGGGCTGGGGCCAGAGG - Intronic
900618801 1:3577654-3577676 TCTCACGGTGCCTGGGCCCGGGG - Intronic
901546299 1:9960401-9960423 TCCCACGGTGCTGGGATTAGAGG - Intronic
901862132 1:12081210-12081232 GCTCACTCTGCTGGGGCCTGGGG - Intronic
902590190 1:17468469-17468491 TCCCACAGTGCTGGGATCTCAGG + Intergenic
903527597 1:24003886-24003908 TCCCAGGGGGCTGGTGCCTTTGG + Intergenic
903708346 1:25303399-25303421 TGCCATGGTGCTGGGTCTTGTGG + Exonic
903718768 1:25389014-25389036 TGCCATGGTGCTGGGTCTTGTGG - Exonic
904837110 1:33346208-33346230 TCCCATAGGGCTGGGGACTGGGG + Intronic
905629654 1:39511487-39511509 TCCCACAGTGCAGGGGCCTCGGG - Intronic
905668105 1:39774703-39774725 TCCCACAGTGCAGGGGCCTCGGG + Intronic
907149194 1:52266782-52266804 TCCCACTGTGATGGTACCTGTGG + Exonic
907371287 1:54005175-54005197 GCCCACAGTGCTGGGGCCTCTGG + Intergenic
910550331 1:88467344-88467366 GCCCACGGCGCCGGGGGCTGGGG - Intergenic
911128450 1:94364401-94364423 TCCCCCAGTCCTGGGGCCTGGGG + Intergenic
912448267 1:109753390-109753412 TCCCACGGTGCAGGTGTCTGGGG + Intronic
914490774 1:148148978-148149000 CGCCACGGTGTTGGGGGCTGGGG + Intronic
914763035 1:150614480-150614502 TCCCACGTAGCTGGGGCCACAGG + Intronic
915103188 1:153515387-153515409 GCCAAAAGTGCTGGGGCCTGTGG + Intergenic
915715538 1:157941279-157941301 CCTCACTGTGCTGGGTCCTGGGG - Intergenic
917845465 1:179016420-179016442 AGCCACAGTGCTGGGCCCTGAGG - Intergenic
917926938 1:179797186-179797208 TCCCACAGTGCTGGGACCACAGG - Intronic
919940120 1:202280725-202280747 GCCCACGGCACTGGGGCCAGGGG - Intronic
920294973 1:204950460-204950482 TCCCTGTGTGCTGGGGCGTGAGG + Intronic
920388913 1:205586646-205586668 TGCCTCTGGGCTGGGGCCTGGGG + Intronic
920494703 1:206446414-206446436 TCCCAGGCTGCTAGGGTCTGGGG + Intronic
922015001 1:221636323-221636345 CCCCAAGGGGCTGGGGCCTCAGG + Intergenic
922660480 1:227425464-227425486 TCCCACAGTGCTAGGTCATGAGG + Intergenic
923634801 1:235684885-235684907 TCCCAAAGTGCTGGGGCCACAGG + Intronic
1063388795 10:5634961-5634983 TTCCACTGTGCTGGGGACAGAGG - Intergenic
1063971928 10:11387217-11387239 TCCCACGGCGCTGGGGCCGGAGG + Intergenic
1064035324 10:11909353-11909375 TCCCACAGTGCTGGGGTCACAGG - Intergenic
1065941363 10:30567113-30567135 TCCCACAGTGCTGGGGGTTGTGG + Intergenic
1067777311 10:49172888-49172910 TCCCACAGGGCTGGCTCCTGGGG + Intronic
1068861860 10:61855644-61855666 TCCCAGACTGCTGGAGCCTGAGG + Intergenic
1069885836 10:71623041-71623063 TGCCACTGTGCTAGGTCCTGGGG + Intronic
1070676432 10:78414918-78414940 TCCCTGTGTGCTGGGGGCTGAGG + Intergenic
1072122898 10:92419965-92419987 CCCCACAGCGCTGGGGCCTGAGG + Intergenic
1072237988 10:93469583-93469605 TCACACCATGCTGGGGCCTGGGG - Intronic
1072449234 10:95526272-95526294 TCCCTCCGGGCTGGGCCCTGTGG + Intronic
1072786531 10:98286877-98286899 TTCCACGCTGCTTGGACCTGAGG - Intergenic
1073191109 10:101651190-101651212 GCTCACAGAGCTGGGGCCTGGGG - Intronic
1074086425 10:110211320-110211342 TCACGCGTTGCTGGGGCCGGAGG + Intronic
1074191289 10:111139794-111139816 GGCCACGGTGCCCGGGCCTGCGG + Intergenic
1074814840 10:117135996-117136018 ACCCATGGTGCTGGGGCAGGGGG + Intronic
1075012596 10:118887489-118887511 TCCCAGAGTGCTTGGTCCTGAGG - Intergenic
1075297093 10:121287189-121287211 TCTCCCGGAGCTGGGGTCTGGGG - Intergenic
1076499369 10:130924331-130924353 TCCCCAGGTCCTGCGGCCTGGGG - Intergenic
1076664627 10:132079162-132079184 CCCCACAGCGCTGGGGTCTGTGG + Intergenic
1077310998 11:1889107-1889129 TCCCATGGTCCTGGGCTCTGGGG + Intronic
1077395665 11:2319917-2319939 TCCCACAGGGGTGGGTCCTGTGG + Intergenic
1077477151 11:2795860-2795882 TCCCATGGGGCGGGGGCCGGGGG + Intronic
1078887888 11:15523581-15523603 TCCCTGGGTGCTTGGGCCTTGGG + Intergenic
1079237020 11:18698581-18698603 TCCCAAGGGGGCGGGGCCTGGGG + Intronic
1080897283 11:36457085-36457107 TCCCAGTGGGCTGGGACCTGCGG + Intronic
1081684992 11:45036126-45036148 TCCTAGGGTGCTGGGCCCTAGGG + Intergenic
1083926751 11:65811965-65811987 GCTGACGGTGCTGTGGCCTGCGG - Intergenic
1084447631 11:69212941-69212963 AGCCACGGAGCTGGGGGCTGGGG + Intergenic
1084548893 11:69828972-69828994 CTCCAGGGTGCTGGGGCCTCAGG + Intergenic
1086404520 11:86488445-86488467 TCACATTGTGCTGGGCCCTGGGG + Intronic
1088382196 11:109205890-109205912 TGTCAGGGTGCTGGGGGCTGGGG - Intergenic
1090238011 11:125163936-125163958 TCCCAGAGTTCTGGGGGCTGGGG - Intergenic
1090387484 11:126365277-126365299 TCCCAGGCTGCAGGGGACTGAGG + Intronic
1090390050 11:126382475-126382497 TCCCAGGCTGCAGGGGACTGAGG + Intronic
1091699602 12:2651077-2651099 TCCCAAGCAGCTGGGGCATGAGG + Intronic
1094470209 12:30795946-30795968 TACCGCGGCGCTGGGTCCTGCGG - Intergenic
1095965163 12:47862769-47862791 TCCCAGGGTTCTGAGGCCGGGGG + Intronic
1096107423 12:49004659-49004681 TTCCACAGTGCTGGGGCTGGGGG + Intronic
1096134265 12:49186559-49186581 TCCCAGGGTGCTGGGACAGGAGG - Intronic
1096144640 12:49269717-49269739 TCCCAGGGTGCTGGGACAGGAGG + Intronic
1096344846 12:50836823-50836845 TCCCATGGTGCTGGGACCACAGG + Intergenic
1096547906 12:52353896-52353918 TCCCAGGGTGGTGTGGTCTGCGG + Intergenic
1097233548 12:57525889-57525911 CCCCACGGTGGAGGGGCCTGGGG + Exonic
1097905897 12:64919471-64919493 TCCCACAGTTCTGGAGGCTGGGG + Intergenic
1099115478 12:78619135-78619157 TCTCACAGTTCTGGAGCCTGAGG + Intergenic
1099467122 12:83001350-83001372 ACCCACCGTGCTGGGCCCTAAGG - Intronic
1099510401 12:83528977-83528999 TGCCATGGTCCTGGGGCATGAGG + Intergenic
1100606378 12:96155139-96155161 TCTCACAGTTCTGGAGCCTGGGG - Intergenic
1101649863 12:106667611-106667633 TACCACAGTACTGGGTCCTGAGG + Intronic
1102955305 12:117054893-117054915 CCCCATGCTGCTGGGGCCTGTGG - Intronic
1103221880 12:119253084-119253106 GTCCAGGGTGCTGGGTCCTGTGG - Intergenic
1103382018 12:120501489-120501511 TCCCAAAGTGCTGGGACATGAGG - Intergenic
1103932347 12:124457454-124457476 GCCCACGTCGCTGGGCCCTGGGG - Intronic
1104501648 12:129292010-129292032 TTCCATGGTGGTGGGGGCTGTGG - Intronic
1105209748 13:18250639-18250661 TCTCACGGTATGGGGGCCTGTGG + Intergenic
1105504677 13:20999267-20999289 TACCAAGGTTCGGGGGCCTGCGG - Intronic
1105755238 13:23457722-23457744 TCCCACTGTGGTGGGCCCAGTGG + Intergenic
1106335368 13:28778420-28778442 GCCCAGGGAGCTGGGGCCTCGGG + Intergenic
1107193808 13:37622986-37623008 TCCCAAAGTGCTGGGGCCACAGG - Intergenic
1107457226 13:40566091-40566113 TCACACATTGCTGGGGCCAGGGG + Intronic
1108261191 13:48658471-48658493 TCACGCTGTGCTAGGGCCTGGGG + Intronic
1108323330 13:49306858-49306880 CCCCATGGTGCTGGGGCCACTGG + Intergenic
1108826647 13:54420193-54420215 TGGCAAGGTGCTGGGGGCTGTGG + Intergenic
1112462996 13:99619374-99619396 TCCCACAGTTCTGGAGGCTGGGG - Intronic
1113537028 13:111076251-111076273 GAACACTGTGCTGGGGCCTGGGG - Intergenic
1113885650 13:113657209-113657231 TCCCACGGTGCCCGGCTCTGGGG - Intronic
1113982860 13:114290542-114290564 TCCCTCTGAGGTGGGGCCTGTGG + Intronic
1114672764 14:24420622-24420644 GCCCATGGTGCAGGGGCCTGGGG + Intergenic
1116057778 14:39885389-39885411 GCCCACGGTGGTGAGGCTTGTGG - Intergenic
1116171021 14:41402389-41402411 TCCCAAAGTGCTGGGGTCAGAGG + Intergenic
1117315488 14:54567403-54567425 TCAGAGGGTGCTGGGGCCAGGGG - Intronic
1118775877 14:68973755-68973777 TCCCACAGTGCCGGTGCCAGTGG - Intronic
1119183344 14:72619030-72619052 TTCCACAGGGCTGGGGCCGGAGG + Intergenic
1120659151 14:87231885-87231907 TCCCAAGCTGCTGGGACCAGAGG + Intergenic
1121023482 14:90597397-90597419 TCCCACGGTGCTGGGGTTACAGG - Intronic
1121029809 14:90648473-90648495 TCCCAAGGTGCTGGGACCACAGG + Intronic
1121391765 14:93582076-93582098 TCCCATGCTGCTGAGGCCAGAGG - Intronic
1121561378 14:94878538-94878560 GCCCCCCGTGCTGGGGACTGGGG + Intergenic
1122415975 14:101549641-101549663 TCCCACGGTGCTGTCGCCTCAGG - Intergenic
1122565832 14:102655067-102655089 TCCCAAAGTGCTGGGGTCTCTGG + Intronic
1122714812 14:103689650-103689672 TCCCACAGTGCTGGGGCTGCTGG + Intergenic
1122962109 14:105099165-105099187 TGCCACTGTGCTGGGGGCTTTGG + Intergenic
1122982463 14:105197816-105197838 TCCCTGGGTGCTCAGGCCTGGGG - Intergenic
1125531499 15:40416394-40416416 TCCCTCACTCCTGGGGCCTGTGG + Intronic
1125691082 15:41596733-41596755 TCCCAAAGTGCTGGGACCAGTGG + Intergenic
1126744334 15:51810828-51810850 CCCCACAGTGCTGTGGGCTGGGG + Exonic
1127962890 15:63902966-63902988 TCCCAAGGTGCTGGGACCACAGG - Intergenic
1128178589 15:65580050-65580072 TGCCACTGTGGTGGGGCCTCAGG + Intronic
1129679917 15:77652930-77652952 ACCCACTGGGCTGGGCCCTGAGG - Intronic
1129742777 15:77997993-77998015 TCCCACTGTGCGGGGGGCAGGGG - Exonic
1129842695 15:78753454-78753476 TCCCACTGTGCGGGGGGCAGGGG + Intergenic
1129895349 15:79101551-79101573 TCCCAAGTAGCTGGGGCCTTAGG + Intergenic
1130557357 15:84932033-84932055 TCCCTGGCTGCTGGGGCCAGGGG - Intronic
1132028028 15:98419504-98419526 CCCCACTGTGATAGGGCCTGGGG - Intergenic
1132084641 15:98897697-98897719 TCCCACGTTGCTGGGACCACAGG + Intronic
1132513442 16:354852-354874 TCCCACAGTGCTGGACACTGGGG + Intergenic
1132554255 16:565680-565702 CCCCGCGGGGCTGGGGTCTGGGG + Intergenic
1132612292 16:823282-823304 TCCCACAGTGCTGGGATCAGAGG + Intergenic
1132647638 16:1006536-1006558 TCCCCTGGTGCTGGGGGCTGGGG - Intergenic
1132744918 16:1432562-1432584 TCCCACGCTTCTGGGGCCTCCGG - Intergenic
1133566635 16:7001713-7001735 TCCCACGGTGCTGGGATCACAGG + Intronic
1133768208 16:8852335-8852357 TCCCACAGTGCTGGGACCAGAGG - Intergenic
1133881450 16:9786385-9786407 TCCCACGGTGCTGGGGCCTGAGG + Intronic
1135043460 16:19135750-19135772 TCCCACTGTGCTGGGGCTGAGGG + Intronic
1135092009 16:19524463-19524485 TCCCACGGTGCTGGAGAGGGAGG + Intronic
1135130538 16:19850548-19850570 CACAACCGTGCTGGGGCCTGGGG - Intronic
1135607314 16:23835946-23835968 TCCCCCGCAGCTGGGGCCAGCGG + Intergenic
1137374777 16:47943230-47943252 ACCCACGTTGCTGGGTGCTGTGG + Intergenic
1137640884 16:50027550-50027572 TCCCAAGTTGCTGGGACCTCGGG - Intronic
1139311219 16:66029884-66029906 TGCCACTCTGCTGGGCCCTGGGG + Intergenic
1139467312 16:67160889-67160911 CCTGACGGTTCTGGGGCCTGAGG - Intronic
1139738836 16:69017307-69017329 TGCCACTGTGCTGGGCCCTGGGG - Intronic
1141596984 16:85103308-85103330 TCTCACGGTGTTGGAGGCTGGGG - Intronic
1142115702 16:88355061-88355083 TCCCACAGACCTCGGGCCTGGGG + Intergenic
1142155027 16:88529019-88529041 TCCCACGGTGCTGGGATCACAGG - Intronic
1142161790 16:88561668-88561690 TCCTACGGTGCCAGGCCCTGGGG + Intergenic
1142161986 16:88562432-88562454 TCCAAACCTGCTGGGGCCTGAGG + Intergenic
1142171684 16:88625739-88625761 TCCCACGGTGCTGGGATCACAGG - Intronic
1142314560 16:89335372-89335394 TCCCATGCTTCTGGGACCTGTGG - Intronic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1142592064 17:1010594-1010616 TCCCAGTGCACTGGGGCCTGTGG - Intronic
1142947934 17:3450109-3450131 TCCCAAAGTGCTGGGGCTAGAGG + Intronic
1142955982 17:3522559-3522581 TCCCAAAGTGCTGGGGGGTGGGG - Intronic
1143150074 17:4802272-4802294 TCCCATGGTGCGGGTGCCGGAGG - Intergenic
1143253059 17:5536996-5537018 TCCCAGGATTCTGGGCCCTGGGG - Intronic
1143649551 17:8255075-8255097 CGCCACTGGGCTGGGGCCTGTGG + Exonic
1144086709 17:11815663-11815685 TCCCGAGTTGCTGGGACCTGAGG - Intronic
1144147916 17:12416078-12416100 TCCCACGGTTCTGAAGGCTGAGG + Intergenic
1144779785 17:17802027-17802049 TGCCACCGTGCTGGGGGCGGGGG - Intronic
1145714095 17:27003216-27003238 CCCCATGGTCCTGGGCCCTGAGG + Intergenic
1146034583 17:29394989-29395011 TCCCAGCATGCTGGGGGCTGAGG + Intronic
1146268675 17:31470257-31470279 ACCCATGGTGCAGGTGCCTGAGG - Intronic
1147326054 17:39670143-39670165 CACCACGCTGCTGAGGCCTGGGG + Exonic
1147365901 17:39958978-39959000 TCCCACGGGGCAGGTGCCTGGGG + Intergenic
1147387625 17:40091406-40091428 TCCCACCCTGCTGGGGCCTCGGG + Intronic
1148150776 17:45395551-45395573 GCCCACGCTGCTGCGGCCCGAGG - Exonic
1148262296 17:46193773-46193795 GCCCTCCGTGCTGGGGCCGGCGG + Intronic
1149293005 17:55235420-55235442 CCACAGGGTGGTGGGGCCTGGGG + Intergenic
1150218203 17:63481769-63481791 TTCCCCGGTTCTGGGGCCCGGGG + Intergenic
1150469487 17:65424739-65424761 TCACACGGTGGTGGGGGCTAGGG - Intergenic
1151188906 17:72383293-72383315 TCCCACGGTGCTGGAGCAGAAGG + Intergenic
1151667358 17:75553023-75553045 CCCCAGGTTGCTGGGGCCTCAGG - Intronic
1152049370 17:77959755-77959777 TCTAACGGTGCTGCGGACTGCGG + Intergenic
1152161743 17:78673054-78673076 TCCCACAGTTCTGGAGCCTTGGG + Intergenic
1152207269 17:78980846-78980868 GCCCAGGCTGCTGGGGCCGGTGG + Intergenic
1152234596 17:79132169-79132191 TCCCAGGGTGAGGGGGCTTGAGG + Intronic
1152757306 17:82092407-82092429 TCCCAGGGAGCAGGAGCCTGAGG + Intronic
1155930517 18:31702797-31702819 GCCCAAGGTGCGGGAGCCTGAGG + Intergenic
1156290386 18:35744387-35744409 TGCCACTGTGCTCGAGCCTGCGG - Intergenic
1158571001 18:58596942-58596964 TCCCAAGAAGCTGGGGCCTCAGG + Intronic
1160298655 18:77659210-77659232 TCCCACAGTGCTGCAGCCAGGGG + Intergenic
1160343145 18:78107155-78107177 CCCCACGGTGCTGTGGCCTGGGG + Intergenic
1160846624 19:1168873-1168895 GCCCTGGGTGCTGGGGCGTGGGG - Intronic
1160869804 19:1272071-1272093 CGCCACGCTGCTGTGGCCTGCGG + Intronic
1160901844 19:1432719-1432741 GCCCAGGGTCCTGGGGCCAGCGG - Intronic
1160959862 19:1715678-1715700 TCCCCCAGGTCTGGGGCCTGTGG + Intergenic
1160994845 19:1877848-1877870 CGCCACGGTGTTGGGGGCTGGGG - Intronic
1161393149 19:4031656-4031678 GCCCGCAGTGCTGGGGGCTGTGG + Intronic
1161508472 19:4657291-4657313 TCCTCCCGCGCTGGGGCCTGTGG + Intronic
1161569738 19:5024007-5024029 TCCCACAGTGCTGGGGTCACAGG + Intronic
1161736514 19:5995216-5995238 CCCCACAGGGCTGGGGCCTCTGG + Intronic
1161738405 19:6005692-6005714 TCCCACGGTGCTGGGAAGTGGGG + Intronic
1161739639 19:6012871-6012893 TCCCAGGATGCTGGAGACTGGGG + Intronic
1161940543 19:7400708-7400730 TCCCAAGTAGCTGGGGCCAGAGG - Intronic
1162161514 19:8721328-8721350 ACCCAAGATGCTGGAGCCTGGGG + Intergenic
1162319093 19:9960238-9960260 TTCCAGGGTGCTGGGGGCTGGGG - Exonic
1163287853 19:16359736-16359758 TCCCACGTAGCTGGGACCTCAGG - Intronic
1163763515 19:19149818-19149840 TCCCAAAGTGCTGGGACCTCAGG - Intronic
1164402201 19:27910072-27910094 TGCCACGGTGGAGGGGGCTGGGG - Intergenic
1164950203 19:32330702-32330724 ATCCACAGTGCTGGGTCCTGAGG + Intergenic
1166042831 19:40213713-40213735 CGCCACGCTGCTGGGGGCTGTGG + Exonic
1166067856 19:40370547-40370569 TCCCAAGGAGCTGGGACCAGAGG - Intronic
1166319891 19:42010927-42010949 TCCCACGGAGCTGGGACCACAGG + Intronic
1166724171 19:45015609-45015631 TCCCATGGTGCTGGGACCCCAGG - Intronic
1166938781 19:46350586-46350608 TCCCACAGCCCTGGAGCCTGGGG - Intronic
1166965624 19:46528117-46528139 TCCCACAGCCCTGGAGCCTGGGG + Intronic
1167283578 19:48585956-48585978 TCCCAAGGTGCTGGGAGCAGAGG - Intronic
1167785005 19:51629433-51629455 TGCCATGGTCCTCGGGCCTGGGG + Exonic
1167787106 19:51645857-51645879 TGCCATGGTCCTCGGGCCTGGGG + Exonic
1168129701 19:54310476-54310498 TCCATCAGTGCTGGGGTCTGAGG - Intronic
1168216234 19:54927967-54927989 TCCCAAGGTGCTGGGGCTACAGG - Intronic
1168326467 19:55541108-55541130 TCCCAGGGTGGTGGTGGCTGAGG + Exonic
1168335260 19:55593544-55593566 CCCCACGGTGCTGGCGCTTGAGG + Exonic
926140822 2:10366861-10366883 TCCAAGGATGCTGGGGCCGGGGG + Intronic
928086191 2:28347854-28347876 CGCCCCGGGGCTGGGGCCTGGGG - Intergenic
928132780 2:28665183-28665205 TCCCAGCGTCCTGGCGCCTGTGG - Intergenic
928179959 2:29062120-29062142 TGCCAAGGTGCTGGGGGCTGGGG - Exonic
928550224 2:32363070-32363092 TCCCAAGGTGCTGGGACCCCAGG - Intronic
929031000 2:37649719-37649741 GCCCCTGGTGCTGGTGCCTGTGG - Intronic
929764929 2:44836540-44836562 TGCCACTGTGCAGGGGGCTGCGG - Intergenic
931277797 2:60759108-60759130 TCCCACGGTGCTGGGATCACAGG - Intronic
932878467 2:75477056-75477078 ACCCACAGAGCTGGGGACTGGGG - Intronic
934660426 2:96140561-96140583 TCACAAGGGGCTGGGGACTGGGG + Intergenic
937288786 2:120769382-120769404 TCCATGGGTGCCGGGGCCTGGGG + Intronic
937348927 2:121147352-121147374 TCCCAAGGTGCTGGGGTCACAGG - Intergenic
937915757 2:127097956-127097978 TCCCTGACTGCTGGGGCCTGAGG + Intronic
938082997 2:128380247-128380269 TCCCAGGGGGCGGGAGCCTGGGG - Intergenic
938087566 2:128411516-128411538 CCCCACGATCCGGGGGCCTGGGG - Intergenic
938116455 2:128605992-128606014 TCCCACCGTCCTGGGGCCAGAGG + Intergenic
938206300 2:129427155-129427177 TCCCAAGGTGCTGGGGTTAGAGG - Intergenic
938296730 2:130183388-130183410 TCCCAGGGTGCAGAGGCCTGCGG + Intronic
938460027 2:131491269-131491291 TCCCAGGGTGCAGAGGCCTGCGG - Intronic
938557320 2:132437493-132437515 TCCCACGGTGCTACCTCCTGAGG + Intronic
941432432 2:165427819-165427841 TCGCATGGTGCTGGCACCTGTGG + Intergenic
943000371 2:182320337-182320359 TCCTAAGGTGCTGGGGTATGAGG + Intronic
943895940 2:193359545-193359567 TCCCAAGCTGCTGGGGCCATAGG - Intergenic
944755764 2:202760320-202760342 TCCCACGCTGCTGAGACCTTTGG - Intronic
946464319 2:219897826-219897848 TCCCACAGTGATGTGGCCTCTGG - Intergenic
947481668 2:230506225-230506247 TCCCCCCATGCTGGGGTCTGGGG - Intronic
947593257 2:231396486-231396508 CCCCAGGTTGCTGGGGCATGTGG - Intronic
947812333 2:233012367-233012389 TCACACCGTGCTGTGGCTTGAGG + Intronic
948181307 2:235983130-235983152 TCCCAGGATGCTGGGGCTGGTGG + Intronic
948206229 2:236164116-236164138 CCCCACGGCGGAGGGGCCTGGGG - Intergenic
948710951 2:239825285-239825307 TCCAAAGTTCCTGGGGCCTGTGG + Intergenic
948796651 2:240406314-240406336 TCCTGCTGTGCTTGGGCCTGGGG - Intergenic
1168748230 20:263316-263338 GCCCACGGTGGTGAGGCTTGCGG - Intergenic
1169344961 20:4822686-4822708 TCCTTCGGAGCTGGTGCCTGAGG - Intronic
1169355800 20:4904034-4904056 TCCCATGGTGCTGGGACCACAGG - Intronic
1170607447 20:17884368-17884390 TGCCACGTTGCTGGAGCCAGGGG - Intergenic
1170946116 20:20892349-20892371 GGCCACACTGCTGGGGCCTGAGG + Intergenic
1171030439 20:21671633-21671655 TCCCACAGTGCTGGGGATTACGG + Intergenic
1171277198 20:23867468-23867490 TCACATGGTGCTGGGTGCTGGGG - Intergenic
1171402315 20:24882788-24882810 TGCCACAGGGCTGGGGGCTGGGG - Intergenic
1171959842 20:31485693-31485715 TCCCCCGGGGCTGGGGCGTCTGG - Intergenic
1172181026 20:33003534-33003556 TCCCAAGGTGCAGGGGGCTCCGG - Intronic
1172221670 20:33278349-33278371 TCCCAGGTTGGTGGGGGCTGTGG + Intronic
1172907752 20:38381627-38381649 TCCCACTATGCTGGAGGCTGAGG - Intergenic
1174201262 20:48808178-48808200 GCCCACGGTGCCTGTGCCTGAGG - Intronic
1174292019 20:49516002-49516024 TCCCAAGGAGCTGGGGCCACAGG + Intronic
1175277632 20:57782996-57783018 TGCCAGGGAGCTGGGGCCTCTGG + Intergenic
1175368481 20:58471171-58471193 ACCCAAGGTGCTGGGGACAGTGG + Intronic
1175715894 20:61253717-61253739 TCCCTCGGTGCTGGGGGTAGAGG + Intronic
1175833335 20:61978764-61978786 TCTCAGCGTGCTGGGCCCTGGGG - Intronic
1175930185 20:62490179-62490201 TTCCACGCTCCTGGGGGCTGCGG + Intergenic
1175996158 20:62813177-62813199 TCCTGCTGGGCTGGGGCCTGGGG - Exonic
1175996219 20:62813357-62813379 TCCTGCCGGGCTGGGGCCTGGGG - Exonic
1175996280 20:62813537-62813559 TCCTGCCGGGCTGGGGCCTGGGG - Exonic
1176148020 20:63574084-63574106 TCCCAGGGTGGCGGGGCCGGGGG - Intronic
1176228487 20:64017551-64017573 TCCCACGGTGCTGGGATCACAGG + Intronic
1176228498 20:64017595-64017617 TCCCACGGTGCTGGGATCACAGG + Intronic
1176359472 21:5982913-5982935 TCACACTGTCCAGGGGCCTGGGG - Intergenic
1177961630 21:27673930-27673952 TCTCCCAGTGCTGGGGGCTGGGG + Intergenic
1178475967 21:32937310-32937332 TTCCACGGGGCTGAGGCCTCAGG - Intergenic
1178695693 21:34791853-34791875 CCCCTGGGTGCTGGGGCCGGCGG + Exonic
1179008010 21:37531518-37531540 TCCCAGGCTGGTGTGGCCTGAGG - Intergenic
1179517232 21:41917038-41917060 TCCCAGGGGCCTGAGGCCTGGGG - Intronic
1179764046 21:43555637-43555659 TCACACTGTCCAGGGGCCTGGGG + Intronic
1179788609 21:43743211-43743233 CCCCACAGTGCTGGGGGCGGGGG - Intronic
1179788678 21:43743414-43743436 CCCCACAGTGCTGGGGGCGGGGG - Intronic
1180134729 21:45855098-45855120 TCCCTCCGTGGTGGAGCCTGGGG - Intronic
1180160982 21:45998624-45998646 TCCCACTGTGGTGTGGCCTGTGG + Intronic
1180728808 22:17965935-17965957 TCCCACGGTGGTTGGTCCCGTGG - Intronic
1180766517 22:18348760-18348782 TCTCACGGTAGGGGGGCCTGCGG - Intergenic
1180779796 22:18513618-18513640 TCTCACGGTAGGGGGGCCTGTGG + Intergenic
1180812512 22:18770939-18770961 TCTCACGGTAGGGGGGCCTGCGG + Intergenic
1180892993 22:19304526-19304548 TCCCAAGTAGCTGGGGCCAGAGG + Intergenic
1181046163 22:20215314-20215336 CTACACGGGGCTGGGGCCTGAGG + Intergenic
1181135636 22:20764173-20764195 ACCCACTGTGCTGAGGCCTCAGG - Intronic
1181182881 22:21079596-21079618 TCCCAGGGTACAGAGGCCTGCGG - Intergenic
1181198669 22:21205186-21205208 TCTCACGGTAGGGGGGCCTGCGG + Intergenic
1181372033 22:22426276-22426298 CCCCACGGTGCTGCAGTCTGTGG + Intergenic
1181738147 22:24898184-24898206 CCCCACGGTGCTGCGACCTAGGG + Exonic
1181765387 22:25087862-25087884 TCCCCAGGTGCTGGGGGCTCTGG - Intronic
1181925260 22:26353546-26353568 GCCCAAGGTTCTGGGGCTTGGGG - Intronic
1181952227 22:26562879-26562901 TCCCAAAGTGCTGGGACCAGGGG + Intronic
1182518491 22:30872067-30872089 TCCCACAGTGCTGGGGGGTGGGG + Intronic
1182557131 22:31135288-31135310 TGCCTGGGTGCTGTGGCCTGAGG - Exonic
1183319722 22:37157540-37157562 TCCCACTGTGCCTGGGACTGAGG + Intronic
1183958842 22:41398763-41398785 TCCTACGGTCCTTTGGCCTGAGG + Exonic
1184240613 22:43209661-43209683 ACCCATGGAGCTGGAGCCTGAGG + Intronic
1184482405 22:44755535-44755557 TCCCACAGTGCAGGGCCCAGAGG - Intronic
1184635567 22:45826018-45826040 TGCCACTGTGCTGTAGCCTGGGG + Intronic
1184860095 22:47168694-47168716 ACCCACTGTTCTGGAGCCTGGGG + Intronic
1185058643 22:48594056-48594078 TTCCAGGGCGCTGAGGCCTGTGG + Intronic
1185096506 22:48808861-48808883 TGCCACAGGGCTTGGGCCTGTGG + Intronic
1185150618 22:49161724-49161746 GCCCATTGTGCTGGGCCCTGCGG + Intergenic
1185341928 22:50294846-50294868 TCCCATGCTGGTGGGGCTTGGGG + Intronic
1203228136 22_KI270731v1_random:89651-89673 TCTCACGGTAGGGGGGCCTGCGG - Intergenic
949363351 3:3254699-3254721 TCCCACAGTGCTGGGGCTACAGG + Intergenic
950025568 3:9817709-9817731 TCCCACGCTGCTACTGCCTGGGG + Exonic
950125397 3:10507026-10507048 TTCCATGGGGCTGGGGGCTGAGG - Intronic
951228554 3:20149370-20149392 TCCCAAGTAGCTGGGGCCTCAGG - Intronic
952633957 3:35505137-35505159 TCCCACGCCACTGGGGCCTAGGG + Intergenic
953761331 3:45689503-45689525 TCCCACGGGCCAGAGGCCTGAGG + Intronic
954370933 3:50169307-50169329 GCACACGGGGCTGGGTCCTGGGG - Intronic
954708526 3:52493797-52493819 CCCCAAGGTCCTGGGGACTGAGG - Intergenic
954762058 3:52882135-52882157 TCACACAGGGCTGGGGGCTGGGG + Intronic
954802021 3:53192838-53192860 GCCCAGGGTCCTGGGGCCAGAGG - Intergenic
956517219 3:70062493-70062515 TGCTACTGTTCTGGGGCCTGAGG - Intergenic
960078836 3:113518858-113518880 TCTCATGGTTCTGGAGCCTGGGG - Intergenic
960142942 3:114168617-114168639 TGCCATGGTGCTGGGGGCTATGG + Intronic
960320077 3:116223812-116223834 TCCCACAATGCTGCTGCCTGAGG + Intronic
961524934 3:127490704-127490726 TCCCACGGGGCAGGTGCCTTCGG - Intergenic
962129666 3:132659760-132659782 TGCCGCGTTGCTGTGGCCTGCGG - Exonic
964871583 3:161319141-161319163 GCCCACAGTGGTGGGGCTTGTGG - Intergenic
966178064 3:177160870-177160892 TCCCAAGGAGCTGGGACCTCAGG - Intronic
966814753 3:183880937-183880959 TCCCACGTGGCTGGGACCAGAGG + Intronic
966869634 3:184281838-184281860 TCCCAAAGTGCTGGGGCCACAGG - Intronic
968426723 4:528539-528561 TCATACGGGGCCGGGGCCTGGGG + Intronic
968473334 4:791770-791792 TCCCACGTAGAAGGGGCCTGGGG - Intronic
968556486 4:1248586-1248608 TCCGACGGGGCTGGGGTCGGTGG + Intronic
968557963 4:1259058-1259080 TCCCACAGTGCTGGGGCTGCAGG + Intergenic
968956269 4:3721389-3721411 TCCCGTGGGGCTGGGACCTGGGG + Intergenic
969670717 4:8588613-8588635 TCCCATGAGGCAGGGGCCTGAGG - Intronic
975609497 4:76190130-76190152 TCCCACGTAGCTGGGGCCACAGG + Intronic
975942357 4:79662164-79662186 TCCAACAGTGCTGGGGCCCTAGG - Intergenic
982767989 4:159369537-159369559 TCCCACGGTTCTGGAGGCAGGGG + Intergenic
983267499 4:165522787-165522809 TCCCACAGTTCTGGAGGCTGGGG - Intergenic
983726871 4:170940283-170940305 ACCCATGCTACTGGGGCCTGGGG + Intergenic
984067037 4:175061922-175061944 TCCCAAGGTGCTGGGACTAGAGG - Intergenic
984702026 4:182824822-182824844 TAACACTGTGCTGGAGCCTGGGG - Intergenic
984827317 4:183938023-183938045 TCCCAAGGAGCTGGGACCTCAGG - Intronic
985590185 5:760495-760517 TCTCACAGTTCTGGGGCCCGGGG - Intronic
985675915 5:1231293-1231315 TCCCCCTGCCCTGGGGCCTGTGG + Intronic
985820669 5:2157909-2157931 TCCCGGGGTGCTCGGGCCTTTGG + Intergenic
985996902 5:3602175-3602197 TCCCGCGGTGCGCGCGCCTGAGG - Intergenic
986245797 5:6005821-6005843 TCCCTGGGTGCTGGGGCCATTGG - Intergenic
987843894 5:23256670-23256692 TATCACAGTTCTGGGGCCTGGGG - Intergenic
992368141 5:76114241-76114263 TCCCATGGTGATGGGGGATGGGG - Intronic
994239572 5:97405854-97405876 TCCCACAGAGCTGGCGCCTGTGG - Intergenic
997417712 5:133741719-133741741 CCGCACTGTGCTGTGGCCTGAGG + Intergenic
997934288 5:138097087-138097109 TCCTCCTGTGCTGGGGCTTGTGG + Intergenic
999053693 5:148550958-148550980 TCCCCCTGAGCTGGGGGCTGTGG - Intronic
999406682 5:151312894-151312916 GCCCATGGTGGTGAGGCCTGTGG + Intergenic
999829965 5:155309088-155309110 TCCCATGTAGCTGGGGCCTCAGG + Intergenic
1003250755 6:4427696-4427718 TACCACGGTGCTGGGCATTGGGG + Intergenic
1003615752 6:7653850-7653872 TCCCATGATTCTGGGGCCAGAGG + Intergenic
1003872907 6:10415788-10415810 TCCCAAGGCGCTGCGGCCCGAGG - Intronic
1004092248 6:12515554-12515576 TCCCAAGGTGCTGGGACCACAGG - Intergenic
1004605658 6:17192872-17192894 TCCCACAGTTCTGGAGGCTGGGG + Intergenic
1006152499 6:31996915-31996937 ATCCACAGGGCTGGGGCCTGGGG - Exonic
1006158805 6:32029652-32029674 ATCCACAGGGCTGGGGCCTGGGG - Exonic
1006330403 6:33386248-33386270 TCCCAAAGTGCTGGGCCCAGCGG - Intergenic
1006647189 6:35522881-35522903 GCCCACGGTGGGAGGGCCTGGGG - Intergenic
1006683103 6:35811510-35811532 ACCCACGGTTCTGGGGACAGTGG - Intronic
1007619531 6:43203587-43203609 TCCCAGGTGGGTGGGGCCTGAGG + Exonic
1007881726 6:45175673-45175695 TACCATGGTGCTAGGCCCTGAGG + Intronic
1008405730 6:51116741-51116763 TCCCAAGCTGCTTGGCCCTGTGG - Intergenic
1009197279 6:60702303-60702325 TCCCAAAGTGCTGGGGGTTGGGG + Intergenic
1011762743 6:90586610-90586632 TCCCACGTTACTGAGGGCTGTGG + Intronic
1013194246 6:107831658-107831680 TCCCACAGTGCTGGGACCACAGG - Intergenic
1013362224 6:109404600-109404622 TCACATGGTGCTAGGGCCTGTGG - Intronic
1015428222 6:133097410-133097432 TCCTAAGGAGCTGGGGCCTGAGG - Intergenic
1019396965 7:826112-826134 TCCCACAGTGCTGGGACCACAGG - Intronic
1021353653 7:19627751-19627773 ACCCATGGTGCTGAGGCTTGGGG - Intergenic
1021638121 7:22711190-22711212 TCCCAAGTTGCTGGGACCAGAGG - Intergenic
1022199081 7:28098316-28098338 TCCCACAGTTCTGGAGGCTGGGG - Intronic
1023319250 7:38975880-38975902 TCCTATGGGGCTGGGGGCTGGGG - Intergenic
1024562476 7:50656045-50656067 TGCCTGGGTGCTGGGGTCTGAGG - Intronic
1026359417 7:69590150-69590172 TCCCAAAGTGCTGGGGCTAGAGG - Intergenic
1026432420 7:70360396-70360418 TCCCAAAGTGCTGGGACTTGAGG + Intronic
1026684236 7:72494616-72494638 TCCCACGGTGCTGGGGCTACAGG - Intergenic
1028920678 7:96306961-96306983 GCCATCGGTGCTGGGACCTGTGG - Intronic
1030371096 7:108700093-108700115 TTCCATTGTGATGGGGCCTGGGG + Intergenic
1030596655 7:111547842-111547864 TCCCAAGGAGCTGGGACCAGAGG + Intronic
1031398583 7:121303768-121303790 ACACCCGGTGCTGGGCCCTGAGG + Intergenic
1031441974 7:121805683-121805705 TCTCACAGTTCTGGGGGCTGGGG - Intergenic
1031447573 7:121873233-121873255 CCGCACGGTGGTGGGGCCCGGGG - Exonic
1032310921 7:130786576-130786598 AACCACAGTGCTGAGGCCTGAGG + Intergenic
1032345610 7:131113780-131113802 TGCCACTGTGCTCCGGCCTGGGG + Intronic
1032839323 7:135701849-135701871 TCCCACAGTGCTGAGGCATGGGG - Intronic
1034105276 7:148484431-148484453 TCCCCCGGTTCTCAGGCCTGCGG - Intergenic
1034849069 7:154476953-154476975 TCCCACGTAGCTGGGACCAGAGG - Intronic
1034883888 7:154783040-154783062 TCCCAAAGTGCTGGGACATGCGG + Intronic
1035024350 7:155816267-155816289 ACCCACAGTCATGGGGCCTGTGG - Intergenic
1035765540 8:2102004-2102026 TCTCTGGGTGCTGGGCCCTGTGG + Intronic
1035957839 8:4101971-4101993 TCCCATGGTGTTGGGGACTGGGG + Intronic
1037709636 8:21345383-21345405 TCCAATTGTGCTGAGGCCTGGGG - Intergenic
1038271654 8:26080683-26080705 TGCCACGCTGGTGTGGCCTGAGG - Intergenic
1039581010 8:38666884-38666906 TCCCCTGCTGCTGGAGCCTGGGG + Intergenic
1041746031 8:61210363-61210385 TCTCACAGTTCTGAGGCCTGGGG - Intronic
1041752751 8:61278856-61278878 TCCCATGCTCCTGGGGCCTCTGG + Intronic
1045277817 8:100722582-100722604 TCCCCCGGAGCTGGGGCTAGAGG - Exonic
1045506230 8:102780776-102780798 GACCACTGTGCTGGGCCCTGGGG + Intergenic
1045586230 8:103540154-103540176 ACCCATGGAGCTGAGGCCTGAGG - Intronic
1048491409 8:134897060-134897082 TCCCACTGTTCTGGGGTCTGTGG - Intergenic
1049222279 8:141433577-141433599 TCCCAGGGTCCTGGGGGCTGGGG - Intergenic
1049229833 8:141476171-141476193 TAGCATGGGGCTGGGGCCTGGGG + Intergenic
1049419836 8:142511596-142511618 CCCCGAGGTGCTGAGGCCTGGGG - Intronic
1049497506 8:142943278-142943300 TCCCCAGGGGCTGGGCCCTGGGG - Intergenic
1049552736 8:143267894-143267916 TCCCACGGGGCTGGGAACAGAGG + Intronic
1049598241 8:143494471-143494493 CCCCACAGTGCAGGAGCCTGTGG + Intronic
1049628047 8:143635534-143635556 TCCCAAAGTGCTGGGACCAGAGG - Intergenic
1050715145 9:8515787-8515809 TCTCACAGTTCTGGGGCCTAGGG - Intronic
1051272096 9:15365545-15365567 TCCCAAAGTGCTGGTGTCTGAGG - Intergenic
1051650061 9:19314194-19314216 TCCCAAGGTGCTGGGGCTACAGG - Intronic
1053198103 9:36135867-36135889 TCCCACGGGGCAGGGGCCATGGG + Intergenic
1054808254 9:69413019-69413041 AGCCACGGTGCTGGGAGCTGCGG - Intergenic
1054869080 9:70032589-70032611 TCCCATGGTGGTGGGGGATGGGG - Intergenic
1056711082 9:88991999-88992021 TTCCACAGTGCCAGGGCCTGGGG + Exonic
1056999855 9:91497492-91497514 CCCCTTGTTGCTGGGGCCTGGGG - Intergenic
1057486045 9:95485080-95485102 TCCCAAGGAGCTGGGGCTAGAGG - Intronic
1060258483 9:122053389-122053411 TCCCACGTGCCTGGAGCCTGGGG + Intronic
1061035469 9:128111679-128111701 TACCTGGGTGCTGGGGCCAGCGG + Intergenic
1061048112 9:128178313-128178335 TCCCACCCTGCTGGGCTCTGTGG + Intronic
1061184153 9:129042354-129042376 TGCCACGGCCCTGGGGACTGTGG + Exonic
1061424388 9:130489991-130490013 TCCTGCGGTACTGGGGTCTGGGG - Intronic
1061818294 9:133208834-133208856 TCACCTGGTGCTGGGGCCCGGGG - Intronic
1061974231 9:134060336-134060358 TCCCAAGGTGCTGGGGTCACAGG - Intronic
1062056797 9:134472994-134473016 TCCCACCGTGCTGTGACCCGGGG - Intergenic
1062242158 9:135546524-135546546 TCACCTGGTGCTGGGGCCCGGGG + Intronic
1062322821 9:135998626-135998648 CCCCTCTGTGCTTGGGCCTGGGG + Intergenic
1062606976 9:137352833-137352855 TCCCTCGGGGCAGGGCCCTGTGG - Intronic
1185632075 X:1522531-1522553 TCCCAAGGTGCTGGGACTAGAGG - Intronic
1185870013 X:3656970-3656992 GCCCTCGGTGAAGGGGCCTGAGG - Intronic
1186110873 X:6254830-6254852 TCCCACGTTGCTGGGACCATAGG + Intergenic
1186282991 X:8014387-8014409 TCCCACTGTGCTGGATCCTATGG - Intergenic
1188236818 X:27741417-27741439 AGCCATGGTGCTGGGGCATGGGG - Intronic
1188495110 X:30775399-30775421 TCCCAAGTAGCTGGGGCCTCAGG - Intergenic
1190303374 X:49068840-49068862 TCACACTGTGCTGGGGACTGGGG + Intronic
1190319615 X:49172388-49172410 TCCCAGGGTGCTGGGAAGTGGGG + Intronic
1192393230 X:70753063-70753085 GCCCACGGTGGCGGGGCTTGTGG - Intronic
1194591425 X:95804694-95804716 TCTCTGGGTGCTGGGGCCTCCGG + Intergenic
1196283757 X:113855705-113855727 TCCCAAGGTGCTGGGACCACAGG - Intergenic
1197032865 X:121839143-121839165 TGCCACAATGCTGGGGGCTGAGG + Intergenic
1199643898 X:149886770-149886792 TCTCAGAGTGCTAGGGCCTGGGG + Intergenic
1199893724 X:152113097-152113119 TCCCAGAGTCCTAGGGCCTGGGG - Intergenic
1200032346 X:153306867-153306889 TCCGAGGGTGCGGGAGCCTGTGG - Intergenic
1200080848 X:153575632-153575654 AGCCACGGGGCTGGGGCCGGGGG + Intronic
1201278690 Y:12321904-12321926 TCCCACGGTGCCAGTGCCTTGGG - Intergenic
1201785349 Y:17771195-17771217 TCCCAAAGTGCTGGGGCAAGGGG - Intergenic
1201816204 Y:18134792-18134814 TCCCAAAGTGCTGGGGCAAGGGG + Intergenic
1202328356 Y:23718012-23718034 TCCCAAAGTGCTGGGGTCAGGGG - Intergenic
1202542415 Y:25952041-25952063 TCCCAAAGTGCTGGGGTCAGGGG + Intergenic