ID: 1133881565

View in Genome Browser
Species Human (GRCh38)
Location 16:9787401-9787423
Sequence ACCCGAAGTGGGGTAGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 180}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133881565_1133881575 18 Left 1133881565 16:9787401-9787423 CCACCCTCTACCCCACTTCGGGT 0: 1
1: 0
2: 0
3: 12
4: 180
Right 1133881575 16:9787442-9787464 TGCACCAATGCATGCCTCACAGG 0: 1
1: 0
2: 1
3: 11
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133881565 Original CRISPR ACCCGAAGTGGGGTAGAGGG TGG (reversed) Intronic
901506833 1:9690184-9690206 AGCCCAAGGGGGCTAGAGGGTGG + Intronic
903768160 1:25748009-25748031 ACCCAAAGAGGGGTAATGGGGGG - Intronic
906869721 1:49464907-49464929 ACCAGGAGAGGAGTAGAGGGTGG - Intronic
909351206 1:74655538-74655560 TCCCTAAATGGGGAAGAGGGAGG - Intronic
915545877 1:156597455-156597477 GCCCGAAGTGGGGTAGTAGATGG + Intronic
915572181 1:156750830-156750852 ACCCGGAGAGGGCTAGATGGAGG - Intronic
924525564 1:244844679-244844701 ACCCGAGGTGGGGCAGGCGGAGG + Exonic
1064019331 10:11796585-11796607 GCCAGAACTGGGGAAGAGGGAGG + Intergenic
1065663296 10:28029110-28029132 ACCAGAAGTGGGAGAGAGGAAGG + Intergenic
1068460905 10:57327131-57327153 ACCAGGAGTGGGATAGAAGGAGG - Intergenic
1070439142 10:76425751-76425773 GCCCGTTGTGGGGTGGAGGGAGG - Intronic
1073305743 10:102502285-102502307 ATCGGAAATGGGGGAGAGGGCGG + Intronic
1074444448 10:113507892-113507914 AGGGGAGGTGGGGTAGAGGGTGG - Intergenic
1075185457 10:120252086-120252108 GCCGGAAGTGGGGAAGGGGGTGG + Intergenic
1076469751 10:130710184-130710206 TCCCCAGGTGGGGTTGAGGGTGG + Intergenic
1078525860 11:12100794-12100816 ACTGGAAGAGGGGCAGAGGGAGG - Intronic
1078664558 11:13313890-13313912 ACCCAAAGTGGGGTGGGGGTGGG - Intronic
1078892828 11:15572868-15572890 ACCAGAAATGGAGTAGAGAGGGG - Intergenic
1079406864 11:20155665-20155687 GACAGAAGTGGGGTAGGGGGTGG + Intergenic
1081975913 11:47234699-47234721 AACCGAGGTGGGGGTGAGGGAGG - Intronic
1082866331 11:57903040-57903062 ACTTGAAGTGGGGTGGGGGGAGG + Intergenic
1083850029 11:65359955-65359977 ACCTGAAGTGGGCTGTAGGGAGG - Intergenic
1084398913 11:68932394-68932416 AGCCGTAGTGGTGCAGAGGGTGG + Intronic
1088014745 11:105045165-105045187 AGCAGAAGTGAGGGAGAGGGAGG - Intronic
1088016854 11:105071373-105071395 AGCAGAAGTGAGGGAGAGGGAGG - Intronic
1089017238 11:115176097-115176119 TCCGAAATTGGGGTAGAGGGAGG + Exonic
1089621302 11:119723958-119723980 ACAAGGAGTGGGGAAGAGGGTGG - Intronic
1090323596 11:125865751-125865773 GCCTGTCGTGGGGTAGAGGGAGG + Intergenic
1090409525 11:126498193-126498215 ACCCGAGGAGGGGAAGAGAGGGG + Intronic
1090805219 11:130198287-130198309 ACCTGGAGTGGGGTAAGGGGAGG - Exonic
1091944464 12:4523801-4523823 ACCCGTCGTGGGGTTGGGGGAGG + Intronic
1092264523 12:6970591-6970613 AGCCGGAGCGGGGTAGAGGCGGG - Exonic
1095885705 12:47186465-47186487 ACTGGTAGGGGGGTAGAGGGGGG + Intronic
1096101673 12:48973667-48973689 ACCCGCAGGCGGCTAGAGGGCGG + Intergenic
1097270789 12:57772651-57772673 ATCCGGAGCGGGGTAGAGGCTGG - Exonic
1098165975 12:67698381-67698403 ACCAAAAGTGGGGTAGGGGTGGG - Intergenic
1099488692 12:83260125-83260147 GCCTGTAGTGGGGTAGGGGGAGG - Intergenic
1100735597 12:97526180-97526202 ACCGGAAGTGGGGTGGGGGATGG - Intergenic
1101509594 12:105380785-105380807 AACAGAACAGGGGTAGAGGGTGG - Intronic
1102006295 12:109591156-109591178 CCCAGCAGTGGGGTGGAGGGAGG - Intronic
1102519899 12:113471676-113471698 GCCCGGAGTGGGGTGGTGGGGGG + Exonic
1104297254 12:127528023-127528045 ACCTTCAGTGGAGTAGAGGGGGG + Intergenic
1104733686 12:131122945-131122967 ACAAGGAGTGGGGTAGGGGGTGG - Intronic
1105217894 13:18300131-18300153 GCCCGAGGTGGGGTTGGGGGGGG - Intergenic
1105885441 13:24637763-24637785 CCCGGAAGTGGGGTAGAGCGCGG + Intergenic
1106787233 13:33119469-33119491 ACCCGAACTTGGGTGGAGGCCGG - Intronic
1109509710 13:63353855-63353877 GCCTGTTGTGGGGTAGAGGGAGG - Intergenic
1109940628 13:69359288-69359310 ACCTGTTGTGGGGTGGAGGGAGG + Intergenic
1111674906 13:91375209-91375231 GGCTGTAGTGGGGTAGAGGGTGG + Intergenic
1113750562 13:112773880-112773902 GCACGAGGTGGGGTGGAGGGTGG - Intronic
1114437118 14:22715308-22715330 ACCTCCAGGGGGGTAGAGGGGGG + Intergenic
1116241914 14:42354413-42354435 ACCTGAGGTGGGGTAGAAAGTGG + Intergenic
1116733922 14:48663976-48663998 ACCAGGAGTGGGGTAGGGAGGGG + Intergenic
1118936277 14:70291686-70291708 AGATGAAGTGAGGTAGAGGGAGG - Intergenic
1120160618 14:81141195-81141217 GCCAGGAGTGGGGTAGAGGATGG + Intronic
1126832128 15:52618479-52618501 ATACAAAGTGGGGAAGAGGGTGG + Intronic
1127719415 15:61684995-61685017 ACTCCAAGTTGGGTAGAGAGTGG + Intergenic
1128367395 15:67013996-67014018 ACCTGCAGTGGGGCTGAGGGAGG + Intergenic
1130749245 15:86692399-86692421 ACCCTTAGTGAGGAAGAGGGTGG + Intronic
1132745912 16:1436237-1436259 CCCCAACGGGGGGTAGAGGGAGG + Intronic
1133832136 16:9333058-9333080 ACCCTAAATGTGGAAGAGGGAGG - Intergenic
1133881565 16:9787401-9787423 ACCCGAAGTGGGGTAGAGGGTGG - Intronic
1134346762 16:13398585-13398607 ACCGGAGGTGGGGTGGGGGGCGG - Intergenic
1136545121 16:30950155-30950177 ACAGGAAGTGGGATGGAGGGAGG + Intronic
1140434028 16:74930034-74930056 AAGCGTAGTGGGGTAGAGCGGGG + Intronic
1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG + Exonic
1140871845 16:79113748-79113770 ACCCGAGGAGGGGAAGAGGGAGG + Intronic
1145767789 17:27471327-27471349 ACTGGAAGTGGGTTAGAGAGAGG + Intronic
1147184789 17:38707201-38707223 GCCTGAGGTGGGGCAGAGGGAGG - Intronic
1147738100 17:42653679-42653701 AGCCGAGGCCGGGTAGAGGGCGG + Intergenic
1151124190 17:71827311-71827333 AGTGGAAGTGGGGTGGAGGGGGG + Intergenic
1151472346 17:74326169-74326191 ACCCGAGGCGGGGCAGGGGGAGG - Intergenic
1152962528 18:88377-88399 ACCGGGAGTGGGGCAGAGTGGGG - Intergenic
1155829241 18:30492220-30492242 AAGAGAAGTGGGGAAGAGGGAGG + Intergenic
1160330565 18:77987757-77987779 ACACGCAGTGAGGAAGAGGGAGG - Intergenic
1162781985 19:13011359-13011381 TCCCGAGGTGGGGTGGTGGGGGG - Intronic
1164670832 19:30071063-30071085 AGCAGAAGTGGGTTGGAGGGGGG + Intergenic
1164836071 19:31355881-31355903 ACCCAAAGTGGGGTGGCGGTGGG - Intergenic
1165844547 19:38809816-38809838 ACTGGAAGTTGGGAAGAGGGTGG - Intronic
1167156034 19:47739794-47739816 AGCTGGAGTTGGGTAGAGGGCGG + Intronic
1167899191 19:52605787-52605809 ACCCAAAGCGGGGTGGGGGGTGG - Intronic
928143289 2:28749609-28749631 ACCACAAGTGAGGCAGAGGGAGG - Intergenic
930282422 2:49386184-49386206 ACCAGAGGTGGGGAAGAGAGGGG - Intergenic
931348773 2:61470707-61470729 ATCCGAAGCGGGGGAGGGGGGGG - Exonic
931465991 2:62487332-62487354 AACCGAAATGAGGAAGAGGGAGG - Intergenic
932173708 2:69580021-69580043 ACAGGAAATGGGGTAGATGGTGG - Intronic
932996138 2:76855791-76855813 ACCCTCAGTTGGGTGGAGGGTGG + Intronic
934847266 2:97669879-97669901 AGCCTAAGTGGGGCAGAGGAGGG + Intergenic
935837542 2:107071948-107071970 ACAGGGAGTGGGGTAGGGGGAGG - Intergenic
938829933 2:135040227-135040249 ACACAAAGTGGGGTATGGGGAGG - Intronic
939495391 2:142922026-142922048 AGCAGAAGTGGCATAGAGGGAGG - Intronic
939657482 2:144846356-144846378 ACCAGGAGTGGGGTATTGGGAGG - Intergenic
939987908 2:148850189-148850211 AGCTGAAATGGGGTAGAGAGAGG + Intergenic
943384736 2:187187146-187187168 GCCTGTAGTGGGGTGGAGGGAGG + Intergenic
944045595 2:195407746-195407768 ACAATAAGTGGAGTAGAGGGTGG + Intergenic
945553765 2:211254066-211254088 ACCTGTTGTGGGGTAGGGGGAGG - Intergenic
947717387 2:232348749-232348771 ACCCATAGTAGGGTGGAGGGAGG - Intergenic
947726550 2:232404940-232404962 ACCCAAAATGGGATAGTGGGTGG - Intergenic
948415462 2:237799410-237799432 ACTCAAGGTGGGGTAGGGGGTGG + Intronic
1168890072 20:1289379-1289401 ACCTGAAGTCAGGTAGAGGGGGG + Intronic
1169091813 20:2865508-2865530 ACTGGAAGTGGGCTGGAGGGAGG - Intronic
1171284838 20:23928539-23928561 ACCCCATGTGGGGTAGAGAGGGG - Intergenic
1175248316 20:57594376-57594398 AACCGAATTGAGGCAGAGGGCGG + Intergenic
1180149933 21:45942277-45942299 CCCAGGAGTGGGGTGGAGGGCGG + Exonic
1183593216 22:38793886-38793908 TCCCGAAGTGGGGGTGAGGGTGG + Intronic
1184105702 22:42366455-42366477 TCCTGAAGTGGGGCAGTGGGGGG + Intergenic
1184708724 22:46234538-46234560 ACCCAGAGTGGGGAGGAGGGTGG - Intronic
949811424 3:8011056-8011078 ACCCAAAGTGGGGTGGTGGGCGG + Intergenic
951515441 3:23554084-23554106 TCCTGAGGTGGGGTTGAGGGGGG + Intronic
952513472 3:34079860-34079882 GCCTGTCGTGGGGTAGAGGGAGG - Intergenic
955956263 3:64293107-64293129 CCCCGGTGTGGGGTAGGGGGTGG + Intronic
955966866 3:64397809-64397831 AGCAGAAGTGGGATAGAGGCAGG - Intronic
956035804 3:65089968-65089990 TCCTGAAGTGGGGTGGAGGGGGG - Intergenic
956293794 3:67690456-67690478 ACCCAAAGTCGGTTAGAGGAAGG + Intergenic
958992043 3:100857738-100857760 ACTCCAAATGGGTTAGAGGGGGG - Intronic
960145127 3:114192914-114192936 AGACGAAGTGGGGTAAAAGGGGG - Intronic
962272398 3:133987505-133987527 ACTTGAAGTGGGGTGGGGGGAGG - Intronic
963146850 3:142002967-142002989 ACATGAAGTGGGGCAGAAGGGGG + Intronic
963221742 3:142820512-142820534 ACCCGAAGTTCAGAAGAGGGAGG - Intronic
963904375 3:150762270-150762292 ACCCAAAGTGGGCTTGAGGGAGG + Intronic
965626978 3:170691206-170691228 ATGCGACGTGGGGTAGAGGGAGG + Intronic
965703796 3:171485481-171485503 ACCAGGAGTGGGGTAGAGAAGGG + Intergenic
967895208 3:194389752-194389774 ACATGCAGTGGGGGAGAGGGAGG + Intergenic
968812048 4:2804574-2804596 ACGCCATGTGGGGTACAGGGAGG - Intronic
968934901 4:3604819-3604841 ACCAGAGGTGGGGCAGCGGGGGG + Intergenic
970523463 4:16908530-16908552 ACCCGAAGCTGGGAAGAGGCAGG + Intergenic
972068187 4:34979459-34979481 ACTAGAAGTGGGAGAGAGGGAGG + Intergenic
974558468 4:63484911-63484933 ACATGAAGTGGGGTAGAGCTAGG - Intergenic
975996338 4:80320737-80320759 GCCTGAAGTGGGGTGGGGGGAGG - Intronic
980943984 4:139301553-139301575 ACCCGTAGTGGGGGAGGCGGCGG + Exonic
982760446 4:159277072-159277094 GCCTGTAGTGGGGTAGGGGGAGG - Intronic
983663290 4:170154171-170154193 GCCTGTCGTGGGGTAGAGGGAGG - Intergenic
985933408 5:3077209-3077231 AGCCGCAGTGGAGTGGAGGGAGG - Intergenic
986901941 5:12446287-12446309 ACCCTCAGTGGGGTAGATAGAGG + Intergenic
988943004 5:36164716-36164738 AACCAAAGTGGGGTTGAGTGCGG - Intronic
991457203 5:66816751-66816773 ATTCTAAGTGGGGTAGAGGATGG - Intronic
991537878 5:67693063-67693085 ACCAGAAGTGGAGTAGTGTGAGG + Intergenic
993733692 5:91451016-91451038 ACCTGAACTGGGGGATAGGGTGG + Intergenic
995468754 5:112478510-112478532 ACCAGGAGTGGGGAAGGGGGTGG + Intergenic
995841237 5:116445188-116445210 GCTGGAAGTGGGGCAGAGGGTGG + Exonic
997974414 5:138431570-138431592 AGACAGAGTGGGGTAGAGGGAGG - Intronic
998261847 5:140637847-140637869 ACTCGAAGTGGGGCGGTGGGGGG - Intergenic
998710836 5:144823493-144823515 AACCGTTGTGGGGTAGGGGGAGG - Intergenic
998999845 5:147908385-147908407 ACCGGGAGTTGGGTAGTGGGAGG - Intergenic
1001442370 5:171753652-171753674 GCCTGTCGTGGGGTAGAGGGAGG + Intergenic
1001929627 5:175663758-175663780 ACTTGAAGTGTGCTAGAGGGGGG - Intronic
1003107898 6:3229306-3229328 TCCCGCTGTGGGGTGGAGGGTGG + Intronic
1003276629 6:4659497-4659519 ACCTGTAGTGGGGTGGGGGGAGG - Intergenic
1004065150 6:12236974-12236996 ACCTGATGTGGGGTGGGGGGAGG - Intergenic
1004424991 6:15501205-15501227 GCTCGAAGCGGGGCAGAGGGTGG - Exonic
1005379193 6:25216598-25216620 CCCAGAAGTGGGGTAGGGGAGGG + Intergenic
1006406606 6:33849220-33849242 ACACGGAGTGGTGTAGATGGTGG + Intergenic
1012313856 6:97760915-97760937 AACAGAAGTTGGGCAGAGGGTGG - Intergenic
1012533948 6:100272887-100272909 ACCTGCCGTGGGGTAGGGGGAGG + Intergenic
1013599875 6:111693799-111693821 CCCAGAAGTGGGCTAGAGTGGGG + Intronic
1015049254 6:128818989-128819011 ACCAGACCTGGGGAAGAGGGAGG - Intergenic
1019042281 6:169117279-169117301 ACAGGATGTGGGGTAGAGGCAGG - Intergenic
1021252815 7:18352773-18352795 AACCAAAGTGGGGAAAAGGGGGG - Intronic
1024630583 7:51243766-51243788 GCCTGAAAGGGGGTAGAGGGAGG + Intronic
1028369694 7:90076874-90076896 GCCTGAAGTGAGGTAGGGGGAGG + Intergenic
1033838740 7:145347838-145347860 GCCTGTCGTGGGGTAGAGGGAGG - Intergenic
1034267396 7:149787809-149787831 ACCTGGAGTGGGGTAGAGGTGGG + Intergenic
1034297446 7:149986922-149986944 ACCCTAATTGGGGTGCAGGGTGG - Intergenic
1034808579 7:154109932-154109954 ACCCTAATTGGGGTGCAGGGTGG + Intronic
1035466823 7:159084722-159084744 GCGCGGAGTGGGGTACAGGGAGG + Intronic
1037901027 8:22689841-22689863 ACCCGAGGTGGGGAAGAGTTTGG + Exonic
1039606347 8:38884020-38884042 ACCAGGAGTGGGGTAAGGGGAGG + Intergenic
1042026780 8:64432393-64432415 ACCTGTTGTGGGGTAGGGGGAGG - Intergenic
1043400262 8:79877574-79877596 ACCCAAAGAGGAGTAGAGAGGGG + Intergenic
1043577355 8:81673371-81673393 ACTAGAAGTGGGGAAGGGGGCGG - Intronic
1046139716 8:110074853-110074875 AACTTAAGTGGGGTGGAGGGGGG + Intergenic
1047623308 8:126630610-126630632 ACCCAGAGGGGTGTAGAGGGTGG + Intergenic
1049757029 8:144315330-144315352 GCCCCCACTGGGGTAGAGGGAGG + Exonic
1051387540 9:16525062-16525084 ACCCGGAGTGGGGGAGGGGGGGG + Intronic
1053009670 9:34625861-34625883 ACCTGAATTGGGGTCAAGGGAGG - Intronic
1054455275 9:65427159-65427181 ACCAGAGGTGGGGCAGCGGGGGG - Intergenic
1061628501 9:131856538-131856560 CCCCGGAGTGGGGTGGGGGGGGG - Intergenic
1061944926 9:133903328-133903350 ACCCAGCGTGGGGTAGAGGAAGG - Intronic
1062735612 9:138135740-138135762 ACCGGGAGTGGGGCAGAGTGGGG + Intergenic
1185841161 X:3392510-3392532 ACCAGAAGTGGGGTTGTAGGAGG - Intergenic
1187617982 X:21019106-21019128 AGACTAAGTGGGGTAAAGGGAGG + Intergenic
1188652756 X:32652285-32652307 TCCCGTAGTGGGGTGGGGGGAGG - Intronic
1188655111 X:32683635-32683657 TCCCGTAGTGGGGTGGGGGGAGG + Intronic
1190446165 X:50526476-50526498 ACCTGTTGTGGGGTAGGGGGAGG + Intergenic
1192210188 X:69123062-69123084 GCCTGAAGTGGGGCAGTGGGTGG - Intergenic
1193380352 X:80809869-80809891 AGCCGAAGTGGCGAAGAGGTGGG + Intergenic
1193734248 X:85137551-85137573 AGCCAGAGTGGGGTAGAGGTGGG - Intergenic
1194020233 X:88680711-88680733 ACCTGTTGTGGGGTAGGGGGAGG + Intergenic
1196670597 X:118362922-118362944 ACCCTAGGTGGGGAAGAGGCAGG + Intronic
1197828745 X:130618984-130619006 AGCTGAAGTGGGGTAGAGATAGG + Intergenic
1198625371 X:138566579-138566601 ACCAGAAGTTGGAAAGAGGGAGG + Intergenic
1199298668 X:146187371-146187393 ACCAGAACTGGGGTGGAGGGAGG - Intergenic
1199844164 X:151678769-151678791 ACTCCAAGTGAGGTAGAGGCGGG - Intergenic